Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
  • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/158—Expression markers

Definitions

• the invention relates to nucleic acid molecules, proteins encoded by such nucleic acid molecules; and use of the proteins and nucleic acid molecules.
• Acid phosphatases are a group of enzymes capable of hydrolyzing esters of orthophosphoric acid in an acid medium (1).
• Four true isoenzymes that is, forms with differences originating at the structural level of the gene) have been identified: erythrocytic, lysosomal, prostatic, and macrophagic acid phosphatases (2).
• the different forms are often associated with particular characteristics that may not necessarily be absolute or specific.
• Erythroid acid phosphatase (ACPI) is a small molecule that belongs to the group of acid phosphatases that are not inhibited by tartrate.
• the gene is 18 kb in length, consists of seven exons (3), and has been mapped to the short arm of chromosome 2 (4).
• the human lysosomal acid phosphatase gene (ACP2) was cloned by Pohlmann et al., and was assigned to chromosome 11 (5).
• ACP2 is about 9 kb in size and is formed of 11 exons.
• the luminal domain is encoded by exons 2 to 10; exon 1 encodes the signal sequence and the first 8 amino acids, while exon 11 encodes the transmembrane and cytoplasmic domains (5,6).
• Human prostatic acid phosphatase was the first urological tumor marker.
• PSA prostate specific antigen
• the chromosomal band 19ql3.3 - l3.4 is nonrandomly rearranged in a variety of solid tumors and harbors malignancy-related genes, including the RRAS oncogene and the apoptosis regulator gene BAX (16).
• a number of kallikrein genes have been located in this region, including PSA and other genes that were found to be differentially expressed in a variety of tumors, including prostate cancer (17-20).
• SUMMARY OF THE INVENTION Applicants identified a novel nucleic acid molecule on human chromosome 19 (19ql3.3) that encodes a testicular acid phosphatase gene, that is homologous to prostatic and lysosomal acid phosphatases.
• the testicular acid phosphatase nucleic acid molecule is formed of 11 exons and the protein is predicted to have a luminal domain, a transmembrane domain and a cytoplasmic domain. The N-terminal end of the protein encodes for a signal peptide.
• the protein has about 50% homology with both the prostatic and lysosomal acid phosphatases, and the position of the cysteine residues, N-glycosylation sites, and the histidine catalytic site are conserved among the three proteins.
• the testicular acid phosphatase nucleic acid molecule is up-regulated by androgens and is down-regulated by estrogens in the prostate cancer cell line LNCaP. The nucleic acid molecule exhibits lower expression in testicular cancer tissues compared to their nonnal counterparts.
• ACPT novel testicular acid phosphatase protein described herein
• ACPT Protein The gene encoding the protein is referred to as " ACPT”.
• ACPT the present invention relates to an isolated ACPT nucleic acid molecule of at least
• nucleotides which hybridizes to any one of SEQ. ID. NOs. 1 through 25, and 39 or the complement of SEQ ID NOs. 1 through 25, and 39 under stringent hybridization conditions.
• the invention also contemplates a nucleic acid molecule comprising a sequence encoding a truncation of an ACPT Protein, an analog, or a homolog of an ACPT Protein or a truncation thereof.
• ACPT Protein and truncations, analogs and homologs of ACPT Protein are also collectively referred to herein as " ACPT Related Proteins").
• nucleic acid molecules of the invention may be inserted into an appropriate expression vector, i.e. a vector that contains the necessary elements for the transcription and translation of the inserted coding sequence.
• recombinant expression vectors adapted for transformation of a host cell may be constructed which comprise a nucleic acid molecule of the invention and one or more transcription and translation elements linked to the nucleic acid molecule.
• the recombinant expression vector can be used to prepare transformed host cells expressing ACPT Related Proteins. Therefore, the invention further provides host cells containing a recombinant molecule of the invention.
• the invention also contemplates transgenic non-human mammals whose germ cells and somatic cells contain a recombinant molecule comprising a nucleic acid molecule of the invention, in particular one which encodes an analog of the ACPT Protein, or a truncation of the ACPT Protein.
• the invention further provides a method for preparing ACPT Related Proteins utilizing the purified and isolated nucleic acid molecules of the invention.
• a method for preparing an ACPT Related Protein comprising (a) transferring a recombinant expression vector of the invention into a host cell; (b) selecting transformed host cells from untransformed host cells; (c) culturing a selected transformed host cell under conditions which allow expression of the ACPT Related Protein; and (d) isolating the ACPT Related Protein.
• the invention further broadly contemplates an isolated ACPT Protein comprising an amino acid sequence as shown in SEQ.ID.NO. 26, 27, 28, 29, 30, or 31 .
• the ACPT Related Proteins of the invention may be conjugated with other molecules, such as proteins, to prepare fusion proteins. This may be accomplished, for example, by the synthesis of N-terminal or C-terminal fusion proteins.
• the invention fiirther contemplates antibodies having specificity against an epitope of an ACPT Related Protein of the invention.
• Antibodies may be labeled with a detectable substance and used to detect proteins of the invention in tissues and cells.
• the invention also permits the construction of nucleotide probes that are unique to the nucleic acid molecules of the invention and/or to proteins of the invention. Therefore, the invention also relates to a probe comprising a nucleic acid sequence of the invention, or a nucleic acid sequence encoding a protein of the invention, or a part thereof.
• the probe may be labeled, for example, with a detectable substance and it may be used to select from a mixture of nucleotide sequences a nucleic acid molecule of the invention including nucleic acid molecules coding for a protein which displays one or more of the properties of a protein of the invention.
• a probe may be used to mark cells.
• the invention still further provides a method for identifying a substance which binds to a protein of the invention comprising reacting the protein with at least one substance which potentially can bind with the protein, under conditions which permit the formation of complexes between the substance and protein and detecting binding. Binding may be detected by assaying for complexes, for free substance, or for non- complexed protein.
• the invention also contemplates methods for identifying substances that bind to other intracellular proteins that interact with an ACPT Related Protein. Methods can also be utilized which identify compounds which bind to ACPT gene regulatory sequences (e.g. promoter sequences).
• the invention provides a method for evaluating a compound for its ability to modulate the biological activity of an ACPT Related Protein of the invention. For example a substance which inhibits or enliances the interaction of the protein and a substance which binds to the protein may be evaluated.
• the method comprises providing a known concentration of an ACPT Related Protein, with a substance which binds to the protein and a test compound under conditions which permit the formation of complexes between the substance and protein, and removing and/or detecting complexes.
• Compounds which modulate the biological activity of a protein of the invention may also be identified using the methods of the invention by comparing the pattern and level of expression of the protein of the invention in tissues and cells, in the presence, and in the absence of the compounds.
• the proteins of the invention and substances and compounds identified using the methods of the invention, and peptides of the invention may be used to modulate the biological activity of an ACPT Related Protein of the invention, and they may be used in the treatment of disorders involving an ACPT Related Protein such as cancer (particularly testicular cancer). Accordingly, the substances and compounds may be formulated into compositions for a ⁇ _ministration to individuals suffering from disorders involving an ACPT Related Protein such as cancer (particularly testicular cancer) in a patient .
• the present invention also relates to a composition
• a composition comprising one or more of a protein of the invention, a peptide of the invention, or a substance or compound identified using the methods of the invention, and a pharmaceutically acceptable carrier, excipient or diluent.
• a method for treating or preventing disorders involving an ACPT Related Protein such as cancer (particularly testicular cancer) in a patient comprising administering to a patient in need thereof, an ACPT Related Protein of the invention, or a composition of the invention.
• the invention provides a method for identifying stimulators or inhibitors of an ACPT Related Protein interaction, comprising
• the reaction mixture is a whole cell. In other embodiments, the reaction mixture is a cell lysate or purified protein composition.
• the subject method can be carried out using libraries of test compounds. Such agents can be proteins, peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries, such as those isolated from animals, plants, fungus and/or microbes.
• Still another aspect of the present invention provides a method of conducting a drug discovery business comprising:
• step (b) conducting therapeutic profiling of agents identified in step (a), or further analogs thereof, for efficacy and toxicity in animals;
• step (c) fonnulating a pharmaceutical preparation including one or more agents identified in step (b) as having an acceptable therapeutic profile.
• the subject method can also include a step of establishing a distribution system for distributing the pharmaceutical preparation for sale, and may optionally include establishing a sales group for marketing the pharmaceutical preparation.
• Figure 1 shows the genomic organization and partial genomic sequence of the testicular acid phosphatase gene. Intronic sequences are not shown except for the splice junction areas. The start and stop codons are encircled and the exon -intron junctions are boxed. The translated amino acids of the coding region are shown underneath by a single letter abbreviation. Amino acids of the histidine phosphatases phosphohistidine signature motif, and the histidine acid phosphatases active site signature motif are highlighted in grey. Residues of the transmembrane domain are underlined. Intron boundaries are shown in lower cases. Full sequence of the gene and its splice variants can be found in GenBank (GenBank accession # AF321918).
• Figure 2 shows the multiple alignment of the amino acid sequences of testicular acid phosphatase (ACPT), prostatic acid phosphatase (ACPP), and lysosomal acid phosphatase (ACP2) proteins. Numbers of the amino acid residues of each protein are shown on the left of each row. Identical residues are highlighted in black, and similar residues in gray. The amino acid residues of the signal peptides are shown in italics. The positions of the conserved cysteine residues are marked by asterisks. N-glycosylation sites are double underlined and transmembrane domains are boxed. The histidine residues important for catalytic activity are shown by an arrow.
• ACPT testicular acid phosphatase
• ACPP prostatic acid phosphatase
• ACP2 lysosomal acid phosphatase
• Figure 3 shows a (A) Plot of hydrophobicity and hydrophilicity of the testicular acid phosphatase
• N basic N-terminal region
• H central hydrophobic region
• P polar C-terminal region
• C cleavage site
• P i E cleavage site
• Figure 4 shows a plot illustrating the predicted domains of testicular acid phosphatase using the "TMt-MM” server. The signal peptide, extracellular, transmembrane and intracellular domains are shown.
• Figure 5 shows a phylogenetic tree using the protein parsimony algorithm. All known human acid phosphatases were included in the analysis, in addition to human alkaline phosphatase and some lysosomal enzymes. The testicular acid phosphatase enzyme was aligned with both the ACPP and ACP2 genes in one group, indicating that these genes arose from a common ancestral gene (see Example for details).
• Proteins included are (the GenBank accession numbers are shown in brackets): erythroid acid phosphatases A and B (NM_004300 and NM_007099), human lysosomal acid phosphatase (NP_001601), human prostatic acid phosphatase (NP_001090), ACP5 (tartrate-resistant acid phosphatase) (NP_001602), human alkaline phosphatase (NP_000469), alpha glucosidase (NP_004659), cathepsin D (NM_001909), and testicular acid phosphatase.
• Figure 6 shows tissue expression of testicular acid phosphatase as determined by RT-PCR. Highest level of expression was found in the testis; however lower levels are also found in many other tissues. More than one band was visible in some tissues. These bands represent the different splice variants of the gene.
• Figure 7 shows hormonal regulation of the testicular acid phosphatase gene in the LNCaP prostatic carcinoma cell line, as determined by RT-PCR. Steroids were added at 10 "8 M final concentration. Actin (not regulated by steroid hormones) was used as a control gene, -ve, negative control.
• Figure 8 shows expression of the testicular acid phosphatase gene in 14 pairs of normal and cancerous testicular tissues, as determined by RT-PCR. The gene was found to be abundant in all 14 normal testicular tissues, very low or undetectable in 10 out of the 14 cancerous counterparts, lower than normal in
• Figure 9 is a schematic presentation of the different splice variants of the testicular acid phosphatase gene. Exons are shown by boxes and introns by the connecting lines. Numbers inside boxes represent the exons lengths in base pairs. The arrowhead points to the common start codon and stars to the position of the stop codon . For full sequence information, see GenBank submission # AF321918 . The exon/intron boundaries for exons 8-11 are not shown. The alternative splicing and/or exon skips create frame shifts which leads to a premature termination. Figure is not drawn to scale.
• Figure 10 shows the relative locations of testicular acid phosphatase (ACPT), pancreatic/renal kallikrein (KLK1), KLK15, and prostate specific antigen (KLK3) genes on chromosome 19ql3.3. Two overlapping BAC clones are identified, and the overlap region is hatched. Genes are represented by horizontal arrows indicating the direction of transcription. The distances between genes are shown in base pairs (bp). Figure is not drawn to scale. DETAILED DESCRIPTION OF THE INVENTION
• the invention provides an isolated nucleic acid molecule having a sequence encoding an ACPT Protein, preferably a protein with ACPT activity.
• the ACPT gene is highly expressed in testis, and expressed in lower levels in the trachea, prostate, bone marrow, spinal cord, colon, fetal brain, heart, thymus, fetal liver, spleen, pancreas, and skeletal muscle.
• nucleic acid refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical reactants, or other chemicals when chemically synthesized.
• An "isolated” nucleic acid may also be free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid molecule) from which the nucleic acid is derived.
• nucleic acid is intended to include DNA and RNA and can be either double stranded or single stranded.
• a nucleic acid molecule encodes an ACPT Protein comprising an amino acid sequence as shown in SEQ.ID.NOs. 26, 27, 28, 29, 30, or 31, preferably a nucleic acid molecule comprising a nucleic acid sequence as shown in any one of SEQ.ID.NO. 1 through 25, and 39.
• the invention provides an isolated nucleic acid molecule which comprises:
• nucleic acid sequence capable of hybridizing under stringent conditions to a nucleic acid sequence in (i), (ii) or (iii); (vi) a nucleic acid sequence encoding a truncation, an analog, an ailelic or species variation of a protein comprising an amino acid sequence of a protein of any one of SEQ. ID. NOs.26 through 31; or (vii) a fragment, or ailelic or species variation of (i), (ii) or (iii).
• an isolated nucleic acid molecule of the invention comprises:
• T can also be U; (ii) nucleic acid sequences complementary to (i), preferably complementary to the full nucleic acid sequence of any one of SEQ. ID. NOs. 1 through 25, and 39;
• nucleic acid capable of hybridizing under stringent conditions to a nucleic acid of (i) or
• the invention includes nucleic acid sequences complementary to a nucleic acid encoding an ACPT
• Protein comprising an amino acid sequence as shown in any one of SEQ. ID. NOs. 26 through 31 preferably the nucleic acid sequences complementary to a full nucleic acid sequence shown in any one of SEQ. ID. NOs. 1 through 25, and 39.
• the invention includes nucleic acid molecules having substantial sequence identity or homology to nucleic acid sequences of the invention or encoding proteins having substantial identity or similarity to the amino acid sequence shown in any one of SEQ. ID. NOs. 26 through 31.
• the nucleic acids have substantial sequence identity for example at least 50%, 55%, 65%, 70%, 75%, 80%, or 85% nucleic acid identity; more preferably 90% nucleic acid identity; and most preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity.
• Identity as known in the art and used herein, is a relationship between two or more amino acid sequences or two or more nucleic acid sequences, as determined by comparing the sequences.
• nucleic acid molecules encoding an ACPT Protein and having a sequence which differs from a nucleic acid sequence of the invention due to degeneracy in the genetic code are also within the scope of the invention.
• nucleic acids encode functionally equivalent proteins (e.g. an ACPT Protein) but differ in sequence from the sequence of an ACPT Protein due to degeneracy in the genetic code.
• DNA sequence polymorphisms within the nucleotide sequence of an ACPT Protein may result in silent mutations which do not affect the amino acid sequence. Variations in one or more nucleotides may exist among individuals within a population due to natural ailelic variation. Any and all such nucleic acid variations are within the scope of the invention.
• DNA sequence polymorphisms may also occur which lead to changes in the amino acid sequence of an ACPT Protein. These amino acid polymorphisms are also within the scope of the present invention.
• nucleic acid molecule which hybridizes under stringent conditions, preferably high stringency conditions to a nucleic acid molecule which comprises a sequence which encodes an ACPT Protein having an amino acid sequence shown in any one of SEQ. LD. NOs. 26 through 31.
• Appropriate stringency conditions which promote DNA hybridization are known to those skilled in the art, or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
• SSC sodium chloride/sodium citrate
• the stringency may be selected based on the conditions used in the wash step.
• the salt concentration in the wash step can be selected from a high stringency of about 0.2 x SSC at 50°C.
• the temperature in the wash step can be at high stringency conditions, at about 65°C.
• the invention includes nucleic acid molecules encoding an ACPT Related Protein including truncations of an ACPT Protein, and analogs of an ACPT Protein as described herein.
• the truncated nucleic acids or nucleic acid fragments may correspond to a sequence of one of SEQ. ID. NOs. 5 to 15, inclusive. It will further be appreciated that variant forms of the nucleic acid molecules of the invention which arise by alternative splicing of an mRNA corresponding to a cDNA of the invention are encompassed by the invention.
• splice variants of an ACPT Related Protein of the invention are contemplated.
• a splice variant (referred to herein as “splice variant 1") is provided wherein the first intron is not spliced out, and, exons 1 and 2 and the intervening intron are all parts of the first exon leading to frame shifting.
• the mRNA is predicted to encode for a truncated protein of 92 amino acids.
• a splice variant is provided (referred to herein as “splice variant 2”) that has the same structure as variant 1 in addition to a deleted exon 7.
• a splice variant is provided (referred to herein as “splice variant 3") that is similar to the regular form but is missing exons 4 and 5 and the last part of exon 3.
• This variant is predicted to encode for a polypeptide chain of 333 amino acids.
• Splice variant 1 is expressed in testis, trachea, prostate, and bone marrow.
• Splice variant 3 is present in bone marrow.
• An isolated nucleic acid molecule of the invention which comprises DNA can be isolated by preparing a labelled nucleic acid probe based on all or part of a nucleic acid sequence of the invention.
• the labeled nucleic acid probe is used to screen an appropriate DNA library (e.g. a cDNA or genomic DNA library).
• a cDNA library can be used to isolate a cDNA encoding an ACPT Related Protein by screening the library with the labeled probe using standard techniques.
• a genomic DNA library can be similarly screened to isolate a genomic clone encompassing a gene encoding an ACPT Related Protein.
• Nucleic acids isolated by screening of a cDNA or genomic DNA library can be sequenced by standard techniques.
• An isolated nucleic acid molecule of the invention which is DNA can also be isolated by selectively amplifying a nucleic acid encoding an ACPT Related Protein using the polymerase chain reaction (PCR) methods and cDNA or genomic DNA. It is possible to design synthetic oligonucleotide primers from the nucleotide sequence of the invention for use in PCR.
• a nucleic acid can be amplified from cDNA or genomic DNA using these oligonucleotide primers and standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
• cDNA may be prepared from mRNA, by isolating total cellular mRNA by a variety of techniques, for example, by using the guanidinium-thiocyanate extraction procedure of Chirgwin et al., Biochemistry, 18, 5294-5299 (1979). cDNA is then synthesized from the mRNA using reverse transcriptase (for example, Moloney MLV reverse transcriptase available from Gibco/BRL, Bethesda, MD, or AMV reverse transcriptase available from Seikagaku America, Inc., St. Russia, FL).
• reverse transcriptase for example, Moloney MLV reverse transcriptase available from Gibco/BRL, Bethesda, MD, or AMV reverse transcriptase available from Seikagaku America, Inc., St. Russia, FL.
• An isolated nucleic acid molecule of the invention which is RNA can be isolated by cloning a cDNA encoding an ACPT Related Protein into an appropriate vector which allows for transcription of the cDNA to produce an RNA molecule which encodes an ACPT Related Protein.
• a cDNA can be cloned downstream of a bacteriophage promoter, (e.g. a T7 promoter) in a vector, cDNA can be transcribed in vitro with T7 polymerase, and the resultant RNA can be isolated by conventional techniques.
• Nucleic acid molecules of the invention may be chemically synthesized using standard techniques. Methods of chemically synthesizing polydeoxynucleotides are known, including but not limited to solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura
• Determination of whether a particular nucleic acid molecule encodes an ACPT Related Protein can be accomplished by expressing the cDNA in an appropriate host cell by standard techniques, and testing the expressed protein in the methods described herein.
• a cDNA encoding an ACPT Related Protein can be sequenced by standard techniques, such as dideoxynucleotide chain termination or Maxam-Gilbert chemical sequencing, to determine the nucleic acid sequence and the predicted amino acid sequence of the encoded protein.
• the initiation codon and untranslated sequences of an ACPT Related Protein may be determined using computer software designed for the purpose, such as PC/Gene (IntelliGenetics Inc., Calif).
• the intron- exon structure and the transcription regulatory sequences of a gene encoding an ACPT Related Protein may be confirmed by using a nucleic acid molecule of the invention encoding an ACPT Related Protein to probe a genomic DNA clone library. Regulatory elements can be identified using standard techniques. The function of the elements can be confirmed by using these elements to express a reporter gene such as the lacZ gene that is operatively linked to the elements. These constructs may be introduced into cultured cells using conventional procedures or into non-human transgenic animal models. In addition to identifying regulatory elements in DNA, such constructs may also be used to identify nuclear proteins interacting with the elements, using techniques known in the art.
• the nucleic acid molecules isolated using the methods described herein are mutant ACPT gene alleles.
• the mutant alleles may be isolated from individuals either known or proposed to have a genotype which contributes to the symptoms of a disorder involving an ACPT Related Protein.
• Mutant alleles and mutant allele products may be used in therapeutic and diagnostic methods described herein.
• a cDNA of a mutant ACPT gene may be isolated using PCR as described herein, and the DNA sequence of the mutant allele may be compared to the normal allele to ascertain the mutation(s) responsible for the loss or alteration of function of the mutant gene product.
• a genomic library can also be constructed using DNA from an individual suspected of or known to carry a mutant allele, or a cDNA library can be constructed using RNA from tissue known, or suspected to express the mutant allele.
• a nucleic acid encoding a normal ACPT gene or any suitable fragment thereof, may then be labeled and used as a probe to identify the corresponding mutant allele in such libraries.
• Clones containing mutant sequences can be purified and subjected to sequence analysis.
• an expression library can be constructed using cDNA from RNA isolated from a tissue of an individual known or suspected to express a mutant ACPT allele. Gene products made by the putatively mutant tissue may be expressed and screened, for example using antibodies specific for an ACPT Related Protein as described herein. Library clones identified using the antibodies can be purified and subjected to sequence analysis.
• sequence of a nucleic acid molecule of the invention, or a fragment of the molecule may be inverted relative to its normal presentation for transcription to produce an antisense nucleic acid molecule.
• An antisense nucleic acid molecule may be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
• An amino acid sequence of an ACPT Protein comprises a sequence as shown in any one of SEQ. ID. NOs. 26 through 31.
• proteins of the present invention include truncations of an ACPT Protein, analogs of an
• ACPT Protein and proteins having sequence identity or similarity to an ACPT Protein, and truncations thereof as described herein (i.e. ACPT Related Proteins).
• Truncated proteins may comprise peptides of between 3 and 70 amino acid residues, ranging in size from a tripeptide to a 70 mer polypeptide.
• the truncated proteins may have an amino group (-NH2), a hydrophobic group (for example, carbobenzoxyl, dansyl, or T-butyloxycarbonyl), an acetyl group, a 9-fluorenylmethoxy-carbonyl (PMOC) group, or a macromolecule including but not limited to lipid-fatty acid conjugates, polyethylene glycol, or carbohydrates at the amino terminal end.
• the truncated proteins may have a carboxyl group, an amido group, a T-butyloxycarbonyl group, or a macromolecule including but not limited to lipid-fatty acid conjugates, polyethylene glycol, or carbohydrates at the carboxy terminal end.
• the invention provides an ACPT Protein that is a splice variant, in particular a nucleic acid molecule comprising or consisting of SEQ. ID. NO. 27, 28, 29, 30, or 31.
• a protein is providing comprising or consisting essentially of amino acids 1 to 390 of SEQ ID NO. 26 (i.e. extracellular domain); amino acids 391 to 413 of SEQ ID NO. 26 (i.e. transmembrane domain- SEQ ID NO. 38); amino acids 414-425 of SEQ ID NO. 26 ( i.e. cytoplasmic domain); amino acids 32 to 46 of SEQ ID NO. 26 (i.e. phosphohistidine signature of histidine phsophatases - SEQ ID NO. 36); or amino acids 282-298 of SEQ ID NO. 26 (active site signature of histidine acid phosphatases - SEQ ID NO. 37).
• the invention provides a signal peptide of an ACPT Related Protein comprising: (a) a basic N-terminal region, a central hydrophobic region, and a more polar C-terminal region, (b) alanine at position -3, and (c) leucine at positions -7 to -13 with the exception of position -8.
• the proteins of the invention may also include analogs of an ACPT Protein, and/or truncations thereof as described herein, which may include, but are not limited to an ACPT protein, containing one or more amino acid substitutions, insertions, and/or deletions.
• Amino acid substitutions may be of a conserved or non-conserved nature. conserveed amino acid substitutions involve replacing one or more amino acids of an ACPT Protein amino acid sequence with amino acids of similar charge, size, and/or hydrophobicity characteristics. When only conserved substitutions are made the resulting analog is preferably functionally equivalent to an ACPT Protein.
• Non-conserved substitutions involve replacing one or more amino acids of the ACPT Protein amino acid sequence with one or more amino acids that possess dissimilar charge, size, and/or hydrophobicity characteristics.
• One or more amino acid insertions may be introduced into an ACPT Protein.
• Amino acid insertions may consist of single amino acid residues or sequential amino acids ranging from 2 to 15 amino acids in length.
• Deletions may consist of the removal of one or more amino acids, or discrete portions from an ACPT Protein sequence.
• the deleted amino acids may or may not be contiguous.
• the lower limit length of the resulting analog with a deletion mutation is about 10 amino acids, preferably 20 to 40 amino acids.
• the proteins of the invention include proteins with sequence identity or similarity to an ACPT Protein and or truncations thereof as described herein.
• Such ACPT Proteins include proteins whose amino acid sequences are comprised of the amino acid sequences of ACPT Protein regions from other species that hybridize under selected hybridization conditions (see discussion of stringent hybridization conditions herein) with a probe used to obtain an ACPT Protein. These proteins will generally have the same regions which are characteristic of an ACPT Protein.
• a protein will have substantial sequence identity for example, about 44%, 45%, 46%, 47%, 48%, 49%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% identity, preferably 90% identity, more preferably at least 95%, 96%, 97%, 98%, or 99% identity, and most preferably 98% identity with an amino acid sequence shown in any one of SEQ. ID. NOs. 26 through 31.
• a percent amino acid sequence homology, similarity or identity is calculated as the percentage of aligned amino acids that match the reference sequence using known methods as described herein.
• the invention also contemplates isoforms of the proteins of the invention.
• An isoform contains Hie same number and kinds of amino acids as a protein of the invention, but the isoform has a different molecular structure.
• Isoforms contemplated by the present invention preferably have the same properties as a protein of the invention as described herein.
• the present invention also includes ACPT Related Proteins conjugated with a selected protein, or a marker protein (see below) to produce fusion proteins. Additionally, immunogenic portions of an ACPT Protein and an ACPT Protein Related Protein are within the scope of the invention.
• An ACPT Related Protein of the invention may be prepared using recombinant DNA methods.
• nucleic acid molecules of the present invention having a sequence which encodes an ACPT Related Protein of the invention may be incorporated in a known manner into an appropriate expression vector which ensures good expression of the protein.
• Possible expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g. replication defective retroviruses, adenoviruses and adeno- associated viruses), so long as the vector is compatible with the host cell used.
• the invention therefore contemplates a recombinant expression vector of the invention containing a nucleic acid molecule of the invention, and the necessary regulatory sequences for the transcription and translation of the inserted protein-sequence.
• Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes [For example, see the regulatory sequences described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic
• the invention further provides a recombinant expression vector comprising a DNA nucleic acid molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is linked to a regulatory sequence in a manner which allows for expression, by transcription of the DNA molecule, of an RNA molecule which is antisense to the nucleic acid sequence of a protein of the invention or a fragment thereof.
• Regulatory sequences linked to the antisense nucleic acid can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance a viral promoter and/or enhancer, or regulatory sequences can be chosen which direct tissue or cell type specific expression of antisense RNA.
• the recombinant expression vectors of the invention may also contain a marker gene which facilitates the selection of host cells transformed or transfected with a recombinant molecule of the invention.
• marker genes are genes encoding a protein such as G418 and hygromycin which confer resistance to certain drugs, ⁇ -galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin preferably IgG.
• the markers can be introduced on a separate vector from the nucleic acid of interest.
• the recombinant expression vectors may also contain genes that encode a fusion moiety which provides increased expression of the recombinant protein; increased solubility of the recombinant protein; and aid in the purification of the target recombinant protein by acting as a ligand in affinity purification.
• a proteolytic cleavage site may be added to the target recombinant protein to allow separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
• Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the recombinant protein.
• GST glutathione S-transferase
• the recombinant expression vectors may be introduced into host cells to produce a transformant host cell.
• Transformant host cells include host cells which have been transformed or transfected with a recombinant expression vector of the invention.
• the terms "transformed with”, “transfected with”, “transformation” and “transfection” encompass the introduction of a nucleic acid (e.g. a vector) into a cell by one of many standard techniques.
• Prokaryotic cells can be transformed with a nucleic acid by, for example, electroporation or calcium-chloride mediated transformation.
• a nucleic acid can be introduced into mammalian cells via conventional techniques such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofectin, electroporation or microinjection. Suitable methods for transforming and transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory textbooks.
• Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells.
• the proteins of the invention may be expressed in bacterial cells such as E. coli, insect cells (using baculovirus), yeast cells, or mammalian cells.
• Other suitable host cells can be found in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1991).
• a host cell may also be chosen which modulates the expression of an inserted nucleic acid sequence, or modifies (e.g. glycosylation or phosphorylation) and processes (e.g. cleaves) the protein in a desired fashion.
• Host systems or cell lines may be selected which have specific and characteristic mechanisms for post-translational processing and modification of proteins.
• eukaryotic host cells including CHO, VERO, BHK, HeLA, COS, MDCK, 293, 3T3, and WI38 may be used.
• cell lines and host systems which stably express the gene product may be engineered.
• Host cells and in particular cell lines produced using the methods described herein may be particularly useful in screening and evaluating compounds that modulate the activity of an ACPT Related Protein.
• the proteins of the invention may also be expressed in non-human transgenic animals including but not limited to mice, rats, rabbits, guinea pigs, micro-pigs, goats, sheep, pigs, non-human primates (e.g. baboons, monkeys, and chimpanzees) [see Hammer et al. (Nature 315:680-683, 1985), Palmiter et al. (Science 222:809-814, 1983), Brinster et al. (Proc Natl. Acad.
• Procedures known in the art may be used to introduce a nucleic acid molecule of the invention encoding an ACPT Related Protein into animals to produce the founder lines of transgenic animals. Such procedures include pronuclear microinjection, retrovirus mediated gene transfer into germ lines, gene targeting in embryonic stem cells, electroporation of embryos, and sperm-mediated gene transfer.
• the present invention contemplates a transgenic animal that carries an ACPT gene in all their cells, and animals which carry the transgene in some but not all their cells.
• the transgene may be integrated as a single transgene or in concatamers.
• the transgene may be selectively introduced into and activated in specific cell types (See for example, Lasko et al, 1992 Proc. Natl. Acad. Sci. USA 89: 6236).
• the transgene may be integrated into the chromosomal site of the endogenous gene by gene targeting.
• the transgene may be selectively introduced into a particular cell type inactivating the endogenous gene in that cell type (See Gu et al Science 265: 103-106).
• the expression of a recombinant ACPT Related Protein in a transgenic animal may be assayed using standard techniques. Initial screening may be conducted by Southern Blot analysis, or PCR methods to analyze whether the transgene has been integrated. The level of mRNA expression in the tissues of transgenic animals may also be assessed using techniques including Northern blot analysis of tissue samples, in situ hybridization, and RT-PCR. Tissue may also be evaluated immunocytochemically using antibodies against
• Proteins of the invention may also be prepared by chemical synthesis using techniques well known in the chemistry of proteins such as solid phase synthesis (Merrifield, 1964, J. Am. Chem. Assoc. 85:2149- 2154) or synthesis in homogenous solution (Houbenweyl, 1987, Methods of Organic Chemistry, ed. E.
• N-terminal or C-terminal fusion proteins comprising an ACPT Related Protein of the invention conjugated with other molecules, such as proteins, may be prepared by fusing, through recombinant techniques, the N-terminal or C-terminal of an ACPT Related Protein, and the sequence of a selected protein or marker protein with a desired biological function.
• the resultant fusion proteins contain an ACPT Protein fused to the selected protein or marker protein as described herein.
• proteins which may be used to prepare fusion proteins include immunoglobulins, glutathione-S-transferase (GST), hemagglutinin (HA), and truncated myc.
• Antibodies ACPT Related Proteins of the invention can be used to prepare antibodies specific for the proteins.
• Antibodies can be prepared which bind a distinct epitope in an unconserved region of the protein.
• An unconserved region of the protein is one that does not have substantial sequence homology to other proteins.
• a region from a conserved region such as a well-characterized domain can also be used to prepare an antibody to a conserved region of an ACPT Related Protein.
• Antibodies having specificity for an ACPT Related Protein may also be raised from fusion proteins created by expressing fusion proteins in bacteria as described herein.
• the invention can employ intact monoclonal or polyclonal antibodies, and immunologically active fragments (e.g.
• Fab fragments and chimeras
• an antibody heavy chain and antibody light chain
• a genetically engineered single chain Fv molecule Ladner et al, U.S. Pat. No. 4,946,778
• a humanized antibody or a chimeric antibody, for example, an antibody which contains the binding specificity of a murine antibody, but in which the remaining portions are of human origin.
• Antibodies including monoclonal and polyclonal antibodies, fragments and chimeras may be prepared using methods known to those skilled in the art.
• nucleic acid molecules, ACPT Related Proteins, and antibodies of the invention may be used in the prognostic and diagnostic evaluation of disorders involving an ACPT Related Protein, and the identification of subjects with a predisposition to such disorders (Section 4.1.1 and 4.1.2).
• Methods for detecting nucleic acid molecules and ACPT Related Proteins of the invention can be used to monitor disorders involving an ACPT Related Protein by detecting ACPT Related Proteins and nucleic acid molecules encoding ACPT Related Proteins. It would also be apparent to one skilled in the art that the methods described herein may be used to study the developmental expression of ACPT Related Proteins and, accordingly, will provide further insight into the role of ACPT Related Proteins.
• the applications of the present invention also include methods for the identification of compounds that modulate the biological activity of a nucleic acid of the invention or ACPT Related Proteins (Section 4.2).
• the compounds, antibodies etc. may be used for the treatment of disorders involving an ACPT Related Protein (Section 4.3). Additional applications are described in Section 4.4.
• a method for detecting the expression of an ACPT Related Protein in a patient comprising:
• nucleic acid molecules, an ACPT Related Protein, and antibodies of the invention may be used in the diagnosis and staging of cancer, in particular testicular cancer.
• a variety of methods can be employed for the diagnostic and prognostic evaluation of disorders involving an ACPT Related Protein, and the identification of subjects with a predisposition to such disorders.
• Such methods may, for example, utilize nucleic acid molecules of the invention, and fragments thereof, and antibodies directed against ACPT Related Proteins, including peptide fragments.
• nucleic acids and antibodies may be used, for example, for: (1) the detection of the presence of CPrmutations, or the detection of either over- or under-expression of A CPT mRNA relative to a non-disorder state or the qualitative or quantitative detection of alternatively spliced forms of ACPT transcripts which may correlate with certain conditions or susceptibility toward such conditions; and (2) the detection of either an over- or an under-abundance of ACPT Related Proteins relative to a non- disorder state or the presence of a modified (e.g., less than full length) ACPT Protein which correlates with a disorder state, or a progression toward a disorder state.
• a modified (e.g., less than full length) ACPT Protein which correlates with a disorder state, or a progression toward a disorder state.
• the methods described herein may be used to evaluate the probability of the presence of malignant or pre-malignant cells, for example, in a group of cells freshly removed from a host. Such methods can be used to detect tumors, quantitate their growth, and help in the diagnosis and prognosis of disease. The methods can be used to detect the presence of cancer metastasis, as well as confinn the absence or removal of all tumor tissue following surgery, cancer chemotherapy, and/or radiation therapy. They can further be used to monitor cancer chemotherapy and tumor reappearance.
• the methods described herein may be performed by utilizing pre-packaged diagnostic kits comprising at least one specific nucleic acid or antibody described herein, which may be conveniently used, e.g., in clinical settings, to screen and diagnose patients and to screen and identify those individuals exhibiting a predisposition to developing a disorder.
• Nucleic acid-based detection techniques are described, below, in Section 4.1.1.
• Peptide detection techniques are described, below, in Section 4.1.2.
• the samples that may be analyzed using the methods of the invention include those which are known or suspected to express a nucleic acid of the invention or contain ACPT Related Proteins.
• the samples may be derived from a patient or a cell culture, and include but are not limited to biological fluids, tissue extracts, freshly harvested cells, and lysates of cells which have been incubated in cell cultures. Oligonucleotides or longer fragments derived from any of the nucleic acid molecules of the invention may be used as targets in a microarray.
• the microarray can be used to simultaneously monitor the expression levels of large numbers of genes and to identify genetic variants, mutations, and polymorphisms.
• the information from the microarray may be used to determine gene function, to understand the genetic basis of a disorder, to diagnose a disorder, and to develop and monitor the activities of therapeutic agents.
• the preparation, use, and analysis of microarrays are well known to a person skilled in the art. (See, for example, Brennan, T. M. et al. (1995) U.S. Pat. No. 5,474,796; Schena, et al. (1996) Proc. Natl. Acad. Sci. 93:10614-10619; Baldeschweiler et al.
• nucleic acid molecules of the invention allow those skilled in the art to construct nucleotide probes for use in the detection of nucleic acid sequences of the invention in samples.
• Suitable probes include nucleic acid molecules based on nucleic acid sequences encoding at least 5 sequential amino acids from regions of the ACPT Protein, preferably they comprise 15 to 30 nucleotides. Examples of probes are the nucleic acid molecules of SEQ ID NOs. 32, 33, 34, or 35.
• a nucleotide probe may be labeled with a detectable substance such as a radioactive label which provides for an adequate signal and has sufficient half- life such as 32 P, 3 H, 14 C or the like.
• detectable substances which may be used include antigens that are recognized by a specific labeled antibody, fluorescent compounds, enzymes, antibodies specific for a labeled antigen, and luminescent compounds.
• An appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleotide to be detected and the amount of nucleotide available for hybridization.
• Labeled probes may be hybridized to nucleic acids on solid supports such as nitrocellulose filters or nylon membranes as generally described in Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual (2nd ed.).
• the nucleic acid probes may be used to detect genes, preferably in human cells, that encode ACPT Related Proteins.
• the nucleotide probes may also be useful in the diagnosis of disorders involving an ACPT Related Protein; in monitoring the progression of such disorders; or monitoring a therapeutic treatment.
• the probe may be used in hybridization techniques to detect genes that encode ACPT Related
• the technique generally involves contacting and incubating nucleic acids (e.g. recombinant DNA molecules, cloned genes) obtained from a sample from a patient or other cellular source with a probe of the present invention under conditions favorable for the specific annealing of the probes to complementary sequences in the nucleic acids. After incubation, the non-annealed nucleic acids are removed, and the presence of nucleic acids that have hybridized to the probe if any are detected.
• nucleic acids e.g. recombinant DNA molecules, cloned genes
• the detection of nucleic acid molecules of the invention may involve the amplification of specific gene sequences using an amplification method such as PCR, followed by the analysis of the amplified molecules using techniques known to those skilled in the art. Suitable primers can be routinely designed by one of skill in the art.
• Genomic DNA may be used in hybridization or amplification assays of biological samples to detect abnormalities involving an ACPT structure, including point mutations, insertions, deletions, and chromosomal rearrangements. For example, direct sequencing, single stranded conformational polymorphism analyses, heteroduplex analysis, denaturing gradient gel electrophoresis, chemical mismatch cleavage, and oligonucleotide hybridization may be utilized.
• Genotyping techniques known to one skilled in the art can be used to type polymorphisms that are in close proximity to the mutations of an ACPT gene.
• the polymorphisms may be used to identify individuals in families that are likely to carry mutations. If a polymorphism exhibits linkage disequalibrium with mutations in an ACPT gene, it can also be used to screen for individuals in the general population likely to carry mutations.
• Polymorphisms which may be used include restriction fragment length polymorphisms (RFLPs), single-base polymorphisms, and simple sequence repeat polymorphisms (SSLPs).
• RFLPs restriction fragment length polymorphisms
• SSLPs simple sequence repeat polymorphisms
• a probe of the invention may be used to directly identify RFLPs.
• a probe or primer of the invention can additionally be used to isolate genomic clones such as YACs, BACs, PACs, cosmids, phage or plasmids. The DNA in the clones can be screened for SSLPs using hybridization or sequencing procedures.
• Hybridization and amplification techniques described herein may be used to assay qualitative and quantitative aspects of ACPT expression.
• RNA may be isolated from a cell type or tissue known to express ACPT and tested utilizing the hybridization (e.g. standard Northern analyses) or PCR techniques referred to herein.
• the techniques may be used to detect differences in transcript size which may be due to normal or abnormal alternative splicing.
• the techniques may be used to detect quantitative differences between levels of full length and/or alternatively splice transcripts detected in normal individuals relative to those individuals exhibiting symptoms of a disorder involving an ACPT Related Protein.
• the primers and probes may be used in the above described methods in situ i.e directly on tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections. 4.1.2 Methods for Detecting ACPT Related Proteins
• Antibodies specifically reactive with an ACPT Related Protein, or derivatives, such as enzyme conjugates or labeled derivatives, may be used to detect ACPT Related Proteins in various samples (e.g. biological materials). They may be used as diagnostic or prognostic reagents and they may be used to detect abnormalities in the level of ACPT Related Protein expression, or abnormalities in the structure, and/or temporal, tissue, cellular, or subcellular location of an ACPT Related Protein. Antibodies may also be used to screen potentially therapeutic compounds in vitro to determine their effects on disorders involving an ACPT Related Protein, and other conditions. In vitro immunoassays may also be used to assess or monitor the efficacy of particular therapies. The antibodies of the invention may also be used in vitro to determine the level of ACPT expression in cells genetically engineered to produce an ACPT Related Protein.
• the antibodies may be used in any known immunoassays which rely on the binding interaction between an antigenic determinant of an ACPT Related Protein and the antibodies.
• assays are radioimmunoassays, enzyme immunoassays (e.g. ELISA), immunofluorescence, immunoprecipitation, latex agglutination, hemagglutination, and histochemical tests.
• the antibodies may be used to detect and quantify ACPT Related Proteins in a sample in order to determine its role in particular cellular events or pathological states, and to diagnose and treat such pathological states.
• the antibodies of the invention may be used in immuno-histochemical analyses, for example, at the cellular and sub-subcellular level, to detect an ACPT Related Protein, to localize it to particular cells and tissues, and to specific subcellular locations, and to quantitate the level of expression.
• Cytochemical techniques known in the art for localizing antigens using light and electron microscopy may be used to detect an ACPT Related Protein.
• an antibody of the invention may be labeled with a detectable substance and an ACPT Related Protein may be localised in tissues and cells based upon the presence of the detectable substance.
• detectable substances include, but are not limited to, the following: radioisotopes (e.g., 3 H, 14 C, 35 S, 125 I, 131 I), fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), luminescent labels such as luminol; enzymatic labels (e.g., horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase, acetylcholinesterase), biotinyl groups (which can be detected by marked avidin e.g., streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or calorimetric methods), predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags).
• labels are attached via spacer arms of various lengths to reduce potential
• the antibody or sample may be immobilized on a carrier or solid support which is capable of immobilizing cells, antibodies etc.
• the carrier or support may be nitrocellulose, or glass, polyacrylamides, gabbros, and magnetite.
• the support material may have any possible configuration including spherical (e.g. bead), cylindrical (e.g. inside surface of a test tube or well, or the external surface of a rod), or flat (e.g. sheet, test strip).
• Indirect methods may also be employed in which the primary antigen- antibody reaction is amplified by the introduction of a second antibody, having specificity for the antibody reactive against ACPT Related Protein.
• the antibody having specificity for an ACPT Related Protein is a rabbit IgG antibody
• the second antibody may be goat anti-rabbit gamma-globulin labeled with a detectable substance as described herein.
• a radioactive label is used as a detectable substance
• an ACPT Related Protein may be localized by radioautography. The results of radioautography may be quantitated by determining the density of particles in the radioautographs by various optical methods, or by counting the grains.
• the invention contemplates a method for monitoring the progression of cancer (e.g. testicular cancer) in an individual, comprising: (a) contacting an amount of an antibody which binds to an ACPT Related Protein, with a sample from the individual so as to form a binary complex comprising the antibody and ACPT Related
• step (c) repeating steps (a) and (b) at a point later in time; and (d) comparing the result of step (b) with the result of step (c), wherein a difference in the amount of complex formation may be indicative of the progression of the cancer in said individual.
• the amount of complexes may also be compared to a value representative of the amount of the complexes from an individual not at risk of, or afflicted with, cancer (e.g. testicular cancer).
• cancer e.g. testicular cancer.
• the methods described herein are designed to identify substances that modulate the biological activity of an ACPT Related Protein, including substances that bind to ACPT Related Proteins, or bind to other proteins that interact with an ACPT Related Protein, to compounds that interfere with, or enhance the interaction of an ACPT Related Protein, substances that bind to the ACPT Related Protein or other proteins that interact with an ACPT Related Protein, or compounds that stimulate or inhibit the activity of an ACPT Related Protein. Methods are also utilized that identify compounds that bind to ACPT regulatory sequences.
• the substances and compounds identified using the methods of the invention include but are not limited to peptides such as soluble peptides including Ig-tailed fusion peptides, members of random peptide libraries and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids, phosphopeptides (including members of random or partially degenerate, directed phosphopeptide libraries), antibodies [e.g. polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, single chain antibodies, fragments, (e.g. Fab, F(ab) 2 , and Fab expression library fragments, and epitope-binding fragments thereof)], and small organic or inorganic molecules.
• peptides such as soluble peptides including Ig-tailed fusion peptides, members of random peptide libraries and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids, phosphopeptides (including members of random or partially degen
• a test compound, compound, or substance may be a natural substance, a biological macromolecule, or an extract made from biological materials such as bacteria, fungi, or animal (particularly mammalian) cells or tissues, an organic or an inorganic molecule, a synthetic test compound, a semi-synthetic test compound, a carbohydrate, a monosaccharide, an oligosaccharide or polysaccharide, a glycolipid, a glycopeptide, a heterocyclic compound, a structural or functional mimetic, a peptide, a peptidomimetic, a derivatised test compound, a peptide cleaved from a whole protein, or peptides synthesised synthetically (such as, by way of example, either using a peptide synthesizer or by recombinant techniques or combinations thereof), a recombinant test compound, a natural or a non-natural test compound, a fusion protein or equivalent thereof and mutants, derivatives or combinations thereof
• Substances which modulate an ACPT Related Protein can be identified based on their ability to bind to an ACPT Related Protein. Therefore, the invention also provides methods for identifying substances that bind to an ACPT Related Protein. Substances identified using the methods of the invention may be isolated, cloned and sequenced using conventional techniques. A substance that associates with a proteinof the invention may be an agonist or antagonist of the biological or immunological activity of a protein of the invention.
• agonist refers to a molecule that increases the amount of, or prolongs the duration of, the activity of the protein.
• antagonists refers to a molecule which decreases the biological or immunological activity of the protein.
• Agonists and antagonists may include proteins, nucleic acids, carbohydrates, or any other molecules that associate with a protein of the invention. Substances which can bind with an ACPT Related Protein may be identified by reacting an ACPT
• substance-ACPT Related Protein with a test substance which potentially binds to an ACPT Related Protein, under conditions which permit the formation of substance- ACPT Related Protein complexes and removing and/or detecting the complexes.
• the complexes can be detected by assaying for substance-ACPT Related Protein complexes, for free substance, or for non-complexed ACPT Related Protein. Conditions which permit the formation of substance-ACPT Related Protein complexes may be selected having regard to factors such as the nature and amounts of the substance and the protein.
• the substance-protein complex, free substance or non-complexed proteins may be isolated by conventional isolation techniques, for example, salting out, chromatography, electrophoresis, gel filtration, fractionation, absorption, polyacrylamide gel electrophoresis, agglutination, or combinations thereof.
• isolation techniques for example, salting out, chromatography, electrophoresis, gel filtration, fractionation, absorption, polyacrylamide gel electrophoresis, agglutination, or combinations thereof.
• antibody against ACPT Related Protein or the substance, or labeled ACPT Related Protein, or a labeled substance may be utilized.
• the antibodies, proteins, or substances may be labeled with a detectable substance as described above.
• An ACPT Related Protein, or the substance used in the method of the invention may be insolubilized.
• an ACPT Related Protein, or substance may be bound to a suitable carrier such as agarose, cellulose, dextran, Sephadex, Sepharose, carboxymethyl cellulose, polystyrene, filter paper, ion- exchange resin, plastic film, plastic tube, glass beads, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, silk, etc.
• the carrier may be in the shape of, for example, a tube, test plate, beads, disc, sphere etc.
• the insolubilized protein or substance may be prepared by reacting the material with a suitable insoluble carrier using known chemical or physical methods, for example, cyanogen bromide coupling.
• the invention also contemplates a method for evaluating a compound for its ability to modulate the biological activity of an ACPT Related Protein of the invention, by assaying for an agonist or antagonist (i.e. enhancer or inhibitor) of the binding of an ACPT Related Protein with a substance which binds with an ACPT Related Protein.
• the basic method for evaluating if a compound is an agonist or antagonist of the binding of an ACPT Related Protein and a substance that binds to the protein is to prepare a reaction mixture containing the ACPT Related Protein and the substance under conditions which permit the formation of substance-ACPT Related Protein complexes, in the presence of a test compound.
• the test compound may be initially added to the mixture, or may be added subsequent to the addition of the ACPT Related Protein and substance.
• Control reaction mixtures without the test compound or with a placebo are also prepared.
• the formation of complexes is detected and the formation of complexes in the control reaction but not in the reaction mixture indicates that the test compound interferes with the interaction of the ACPT Related Protein and substance.
• the reactions may be carried out in the liquid phase or the ACPT Related Protein, substance, or test compound may be immobilized as described herein.
• the ability of a compound to modulate the biological activity of an ACPT Related Protein of the invention may be tested by determining the biological effects on cells.
• agonists and antagonists i.e. inhibitors and enhancers that can be assayed using the methods of the invention may act on one or more of the binding sites on the protein or substance including agonist binding sites, competitive antagonist binding sites, non-competitive antagonist binding sites or allosteric sites.
• the invention also makes it possible to screen for antagonists that inhibit the effects of an agonist of the interaction of ACPT Related Protein with a substance which is capable of binding to the ACPT Related Protein.
• the invention may be used to assay for a compound that competes for the same binding site of an ACPT Related Protein.
• the invention also contemplates methods for identifying compounds that bind to proteins that interact with an ACPT Related Protein.
• Protein-protein interactions may be identified using conventional methods such as co-immunoprecipitation, crosslinking and co-purification through gradients or chromatographic columns. Methods may also be employed that result in the simultaneous identification of genes which encode proteins interacting with an ACPT Related Protein. These methods include probing expression libraries with labeled ACPT Related Protein.
• Two-hybrid systems may also be used to detect protein interactions in vivo. Generally, plasmids are constructed that encode two hybrid proteins.
• a first hybrid protein consists of the DNA-binding domain of a transcription activator protein fused to an ACPT Related Protein
• the second hybrid protein consists of the transcription activator protein's activator domain fused to an unknown protein encoded by a cDNA which has been recombined into the plasmid as part of a cDNA library.
• the plasmids are transformed into a strain of yeast (e.g. S. cerevisiae) that contains a reporter gene (e.g. lacZ, luciferase, alkaline phosphatase, horseradish peroxidase) whose regulatory region contains the transcription activator's binding site.
• the hybrid proteins alone cannot activate the transcription of the reporter gene. However, interaction of the two hybrid proteins reconstitutes the functional activator protein and results in expression of the reporter gene, which is detected by an assay for the reporter gene product.
• fusion proteins may be used in the above-described methods.
• ACPT Related Proteins fused to a glutathione-S-transferase may be used in the methods.
• the invention also relates to enzyme assays for identifying compounds that modulate the activity of an ACPT Related Protein.
• Acid phosphatases hydrolyze esters of orthophosphoric acid. Therefore, the invention contemplates a method for screening for a compound that affects the acid phosphatase activity of an ACPT Related Protein.
• the invention also contemplates cell-based assays for screening for compounds that modulate an ACPT Related Protein or nucleic acid molecule of the invention.
• Compounds that inhibit or stimulate activity of an ACPT Related Protein may be assayed by treating cells which express an ACPT Related Protein with a compound suspected of inhibiting or stimulating the
• ACPT Related Protein and comparing the morphology of the cells or a property of the cells with the morphology or property of the cells in the absence of the substance or cells which do not express the ACPT
• Compounds which inhibit or stimulate transcription or translation of a nucleic acid encoding an ACPT Related Protein may be identified by transfecting a cell with an expression vector comprising a recombinant molecule containing a nucleic acid sequence encoding an ACPT Related Protein, the necessary elements for the transcription or translation of the nucleic acid sequence and a reporter gene, in the presence of a substance suspected of inhibiting or stimulating transcription or translation of the gene encoding the ACPT Related Protein, and comparing the level of expression of the ACPT Related Protein or the expression of the protein encoded by the reporter gene with a control cell transfected with the nucleic acid molecule in the absence of the substance.
• the method can be used to identify transcription and translation inhibitors or stimulators of a gene encoding an ACPT Related Protein.
• Suitable transcription and translation elements may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes. Selection of appropriate transcription and translation elements is dependent on the host cell chosen, and may be readily accomplished by one of ordinary skill in the art. Examples of such elements include: a transcriptional promoter and enhancer, an RNA polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal. Additionally, depending on the host cell chosen and the vector employed, other genetic elements, such as an origin of replication, additional DNA restriction sites, enhancers, and sequences conferring inducibility of transcription may be incorporated into the expression vector. It will also be appreciated that the necessary transcription and translation elements may be supplied by the native gene and/or its flanking sequences.
• reporter genes are genes encoding a protein such as ⁇ -galactosidase (e.g. lac Z), chloramphenicol, acetyl-transferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin preferably IgG. Transcription of the reporter gene is monitored by changes in the concentration of the reporter protein such as ⁇ -galactosidase, chloramphenicol acetyltransferase, or firefly luciferase. This makes it possible to visualize and assay for expression of recombinant molecules to determine the effect of a substance on expression of a nucleic acid molecule encoding an ACPT Related Protein.
• ⁇ -galactosidase e.g. lac Z
• chloramphenicol acetyl-transferase
• firefly luciferase or an immunoglobulin or portion thereof such as the Fc portion of an
• Mammalian cells suitable for carrying out the present invention include malignant cells, for example, COS (e.g., ATCC No. CRL 1650 or 1651), BHK (e.g., ATCC No. CRL 6281), CHO (ATCC No. CCL 61), HeLa (e.g., ATCC No. CCL 2), and 293 (ATCC No. 1573).
• Suitable expression vectors for directing expression in mammalian cells generally include a promoter. Common promoters include SV40, MMTV, metallothionein-1, adenovirus Ela, CMV, immediate early, immunoglobulin heavy chain promoter and enhancer, and RSV-LTR.
• Protocols for the transfection of mammalian cells include calcium phosphate mediated electroporation, retroviral, and protoplast fusion-mediated transfection (see Sambrook et al., Molecular Cloning A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, 1989).
• the invention contemplates a compound, substance, inhibitor, or stimulator identified by a method of the invention.
• the reagents suitable for applying the methods of the invention to evaluate compounds that modulate an ACPT Related Protein may be packaged into convenient kits providing the necessary materials packaged into suitable containers.
• the kits may also include suitable supports useful in performing the methods of the invention.
• proteins of the invention substances or compounds identified by the methods described herein, antibodies, nucleic acid molecules including antisense nucleic acid molecules of the invention may be used for modulating the biological activity of an ACPT Related Protein or a nucleic acid molecule of the invention, and they may be used in the treatment of disorders involving an ACPT Related Protein or a nucleic acid molecule of the invention (e.g. testicular cancer) in a patient.
• ACPT Related Protein e.g. testicular cancer
• the proteins, substances, antibodies, and compounds may be formulated into pharmaceutical compositions for administration to subjects in a biologically compatible form suitable for ac-ministration in vivo.
• biologically compatible form suitable for administration in vivo is meant a form of the active substance to be administered in which any toxic effects are outweighed by the therapeutic effects.
• the active substances may be administered to living organisms including humans and animals.
• Administration of a therapeutically active amount of a pharmaceutical composition of the present invention is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result.
• a therapeutically active amount of a substance may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of antibody to elicit a desired response in the individual. Dosage periods may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
• the active substance may be administered in a convenient manner such as by injection (subcutaneous, intravenous, etc.), oral administration, inhalation, transdermal application, or rectal administration.
• the active substance may be coated in a material to protect the substance from the action of enzymes, acids and other natural conditions that may inactivate the substance.
• compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions which can be administered to subjects, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle.
• Suitable vehicles are described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA 1985).
• the compositions include, albeit not exclusively, solutions of the active substances in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso-osmotic with the physiological fluids.
• compositions are indicated as therapeutic agents either alone or in conjunction with other therapeutic agents or other forms of treatment (e.g. chemotherapy or radiotherapy).
• the compositions may be used in combination with anti-proliferative agents, antimicrobial agents, immunostimulatory agents, or anti-inflammatories.
• the compounds may be used in combination with anti-viral and/or anti-proliferative agents.
• the compositions of the invention may be administered concurrently, separately, or sequentially with other therapeutic agents or therapies.
• Vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids, may be used to deliver nucleic acid molecules to a targeted organ, tissue, or cell population. Methods well known to those skilled in the art may be used to construct recombinant vectors which will express antisense nucleic acid molecules of the invention. (See, for example, the techniques described in
• nucleic acid molecules comprising full length cDNA sequences and/or their regulatory elements enable a skilled artisan to use sequences encoding a protein of the invention as an investigative tool in sense (Youssoufian H and H F Lodish 1993 Mol Cell Biol 13:98-104) or antisense (Eguchi et al (1991) Annu Rev Biochem 60:631-652) regulation of gene function.
• sense or antisense o-igomers. or larger fragments can be designed from various locations along the coding or control regions.
• Genes encoding a protein of the invention can be turned off by transfecting a cell or tissue with vectors which express high levels of a desired ACPT-encoding fragment.
• Such constructs can inundate cells with untranslatable sense or antisense sequences. Even in the absence of integration into the DNA, such vectors may continue to transcribe RNA molecules until all copies are disabled by endogenous nucleases.
• Modifications of gene expression can be obtained by designing antisense molecules, DNA, RNA or PNA, to the regulatory regions of a gene encoding a protein of the invention, ie, the promoters, enhancers, and introns.
• oligonucleotides are derived from the transcription initiation site, eg, between -10 and +10 regions of the leader sequence.
• the antisense molecules may also be designed so that they block translation of mRNA by preventing the transcript from binding to ribosomes.
• Triple helix pairing compromises the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules.
• Therapeutic advances using triplex DNA were reviewed by Gee J E et al (In: Huber B E and B I Carr (1994) Molecular and Immunologic Approaches, Futura Publishing Co, Mt Kisco N.Y.).
• Ribozymes are enzymatic RNA molecules that catalyze the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
• the invention therefore contemplates engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding a protein of the invention.
• Specific ribozyme cleavage sites within any potential RNA target may initially be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once the sites are identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the oligonucleotide inoperable. The suitability of candidate targets may also be determined by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
• vectors may be introduced into stem cells obtained from a patient and clonally propagated for autologous transplant into the same patient (See U.S. Pat. Nos. 5,399,493 and 5,437,994). Delivery by transfection and by liposome are well known in the art.
• the activity of the proteins, substances, compounds, antibodies, nucleic acid molecules, agents, and compositions of the invention may be confirmed in atiimal experimental model systems.
• Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or with experimental animals, such as by calculating the ED 50 (the dose therapeutically effective in 50% of the population) or LD 50 (the dose lethal to 50% of the population) statistics.
• the therapeutic index is the dose ratio of therapeutic to toxic effects and it can be expressed as the ED 50 LD 50 ratio.
• Pharmaceutical compositions which exhibit large therapeutic indices are preferred.
• nucleic acid molecules disclosed herein may also be used in molecular biology techniques that have not yet been developed, provided the new techniques rely on properties of nucleotide sequences that are currently known, including but not limited to such properties as the triplet genetic code and specific base pair interactions.
• the invention also provides methods for studying the function of a protein of the invention.
• Cells, tissues, and non-human animals lacking in expression or partially lacking in expression of a nucleic acid molecule or gene of the invention may be developed using recombinant expression vectors of the invention having specific deletion or insertion mutations in the gene.
• a recombinant expression vector may be used to inactivate or alter the endogenous gene by homologous recombination, and thereby create a deficient cell, tissue, or animal.
• Null alleles may be generated in cells, such as embryonic stem cells by deletion mutation.
• a recombinant gene may also be engineered to contain an insertion mutation that inactivates the gene.
• Such a construct may then be introduced into a cell, such as an embryonic stem cell, by a technique such as transfection, electroporation, injection etc.
• Cells lacking an intact gene may then be identified, for example by Southern blotting, Northern Blotting, or by assaying for expression of the encoded polypeptide using the methods described herein.
• Such cells may then be fused to embryonic stem cells to generate transgenic non-human animals deficient in a protein of the invention.
• Germline transmission of the mutation may be achieved, for example, by aggregating the embryonic stem cells with early stage embryos, such as 8 cell embryos, in vitro; transferring the resulting blastocysts into recipient females and; generating gennline transmission of the resulting aggregation chimeras.
• Such a mutant animal may be used to define specific cell populations, developmental patterns and in vivo processes, normally dependent on gene expression.
• the invention thus provides a transgenic non-human mammal all of whose germ cells and somatic cells contain a recombinant expression vector that inactivates or alters a gene encoding an ACPT Related Protein.
• the invention provides a transgenic non-human mammal all of whose germ cells and somatic cells contain a recombinant expression vector that inactivates or alters a gene encoding an ACPT Related Protein resulting in an ACPT Related Protein associated pathology.
• the invention provides a transgenic non-human mammal which doe not express, or has reduced expression of, an ACPT Related Protein of the invention.
• the invention provides a transgenic non-human mammal which does not express, or has reduced expression of, an ACPT Related Protein of the invention resulting in an
• ACPT Related Protein associated pathology refers to a phenotype observed for an ACPT Related Protein homozygous mutant or heterozygous mutant.
• a transgenic non-human animal includes but is not limited to mouse, rat, rabbit, sheep, hamster, dog, cat, goat, and monkey, preferably mouse.
• the invention also provides a transgenic non-human animal assay system which provides a model system for testing for an agent that reduces or inhibits a pathology associated with an ACPT Related Protein, preferably an ACPT Related Protein associated pathology, comprising: (a) administering the agent to a transgenic non-human animal of the invention; and
• step (b) determining whether said agent reduces or inhibits the pathology (e.g. ACPT Related Protein associated pathology) in the transgenic non-human animal relative to a transgenic non-human animal of step (a) which has not been administered the agent.
• the agent may be useful in the treatment and prophylaxis of conditions such as cancer as discussed herein.
• the agents may also be incorporated in a pharmaceutical composition as described herein. The following non-limiting examples are illustrative of the present invention:
• Sequencing information around the chromosomal region 19ql3.3 and bacterial artificial chromosome (BAG) localization maps were obtained from the Lawrence Livermore National Laboratory (LLNL). Using different gene prediction programs, a putative new gene was identified in this region.
• the BAC clone that contains this gene (BC 781134) was obtained from the LLNL. This clone was digested, blotted on a membrane and hybridized with gene-specific probes for the putative testicular acid phosphatase gene. Probes were synthesized according to the predicted sequence of the new gene and positive fragments were subcloned and sequenced to verify the structure of the putative gene. Expressed sequence tag (EST) searching
• the predicted exons of the putative new gene were subjected to homology search using the BLASTN algorithm (21) on the National Center for Biotechnology Information web server (hrtp://www ncbi.nlm.nih.gov/BLAST/) against the human EST database (dbEST).
• Five clones with 99% identity were obtained from the I.M.A.G.E. consortium (22) through Research Genetics Inc, Huntsville, AL (Table 1).
• the clones were propagated, purified and sequenced from both directions with an automated sequencer, using insert-flanking vector primers. Rapid amplification of cDNA ends (5' RACE)
• RNA isolated from 25 different human tissues was purchased from Clontech.
• cDNA was prepared as described below, and used for PCR reactions. Tissue cDNAs were amplified at various dilutions. To exclude non-specific amplification, the PCR products were cloned into the pCR 2.1-TOPO vector
• RT-PCR Reverse transcriptase polymerase chain reaction
• R6PD 5' ACATGTTGGGGTCCAGTGTCA 3' (SEQ ID NO 35)]
• PCR was carried out in a reaction mixture containing 1 ⁇ l of cDNA, 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 mM MgCl 2 , 200 ⁇ M dNTPs (deoxynucleoside triphosphates), 150 ng of primers and 2.5 units of HotStarTM DNA polymerase (Qiagen Inc., Valencia, CA) on a Perkin-Elmer 9600 thermal cycler.
• the cycling conditions were 94°C for 15 min to activate the polymerase, followedby 45 cycles of 94°C for 30 s, 64°C for 30 s, and 72° for 1 min, and a final extension step at 72°C for 10 min.
• Equal amounts of PCR products were electrophoresed on 1.5% agarose gels and visualized by ethidium bromide staining. All primers for RT-PCR spanned at least 2 exons to avoid contamination by genomic DNA.
• Prostate cancer cell line and hormonal stimulation experiments were 94°C for 15 min to activate the polymerase, followedby 45 cycles of 94°C for 30 s, 64°C for 30 s, and 72° for 1 min, and a final extension step at 72°C for 10 min.
• Equal amounts of PCR products were electrophoresed on 1.5% agarose gels and visualized by ethidium bromide staining. All primers for RT-PCR spanned at least 2 exons to avoid contamination by genomic DNA.
• the LNCaP prostate cancer cell line was purchased from the American Type Culture Collection (ATCC), Rockville, MD. Cells were cultured in RPMI media (Gibco BRL) supplemented with glutamine (200 mmol/L), bovine insulin (10 mg/L), fetal bovine serum (10%), antibiotics and antimycotics, in plastic flasks, to near confluency. The cells were then aliquoted into 24-well tissue culture plates and cultured to 50% confluency.24 hours before the experiments, the culture media were changed into phenol red-free media containing 10% charcoal-stripped fetal bovine serum. For stimulation experiments, various steroid hormones dissolved in 100% ethanol were added into the culture media at a final concentration of 10 "8 M. Cells stimulated with 100% ethanol were included as controls. The cells were cultured for 24 hours, then harvested for mRNA extraction. Testicular cancer tissue specimens
• testicular tissue samples were obtained from 14 patients who had undergone radical orchiectomy for testicular tumors at the Charite University Hospital, Berlin, Germany. Six tumors were seminomas and 8 tumors were non-seminomas. The patients did not receive any hormonal therapy before surgery. The use of these tissues for research purposes was approved by the Ethics Committee of the Charite Hospital. Fresh testicular tissue samples were obtained from the cancerous and non-cancerous parts of the same testis that had been removed. Small pieces of tissue were dissected immediately after removal of the testis and stored in liquid nitrogen until analysis. Histological analysis from all the tissue pieces was performed as previously described (23), to ensure that the tissue was either malignant or benign. The tissues were pulverized with a hammer under liquid nitrogen and RNA was extracted using RNeasyTM mini spin columns (QIAGEN) following the manufacturer instructions. Results
• the BAG clone (BC 781134) was obtained from the LLNL, purified, digested and probed with a testicular acid phosphatase-specific probe. A positive fragment was sequenced to obtain the genomic structure of the gene.
• EST database search, PCR using exon-specific primers derived from the predicted exons of the gene, rapid amplification of cDNA ends (5' RACE) and protein and domain homology search were used to identify the full structure of the testicular acid phosphatase gene.
• the testicular acid phosphatase (ACPT) gene is formed of eleven coding exons and ten intervening introns and spans five kb of genomic nucleotide sequence ( Figure 1). All exon/intron boundaries comply with the GT/ AG rule and are in good agreement with the consensus sequence of splice junctions (24).
• the cDNA of the gene is formed of 1281 bp, encoding for a protein chain of 426 amino acids with a predicted molecular mass of 46.1 kDa.
• the methionine translation initiation codon is located in the first exon and, as is the case with most vertebrate mRNAs, the start codon is surrounded by a purine in position -3 and a (G) in position +4 (25).
• testicular acid phosphatase shows 48% identity and 63% similarity with the human lysosomal acid phosphatase and 44% identity and 60% similarity with the prostatic acid phosphatase. No significant homology was found with erythroid or type 5 acid phosphatases.
• the amino acid sequence of the gene starts with a putative signal peptide of 28 amino acids ( Figure 2).
• This signal peptide has the structural features characteristic of a signal peptide (26,27): 1) a basic N-terminal region, a central hydrophobic region, and a more polar C-terminal region. 2) Alanine is present at position -3 3) Leucine is present at positions -7 to -13 with the exception of position -8 ( Figure 3).
• testicular acid phosphatase In order to study the phylogenetic relatedness of the new testicular acid phosphatase, its amino acid sequence was aligned with all known acid phosphatases, human alkaline phosphatase, and some known lysosomal enzymes using the "Clustal X" multiple alignment program. Distance matrix and parsimony trees were constructed using the Neighbor-joining/UPGMA and Protpars parsimony methods. All possible trees grouped testicular acid phosphatase together with both the ACPP and ACP2 in one group ( Figure 5). Tissue expression and hormonal regulation of the testicular acid phosphatase gene cDNA from 25 normal human tissues was screened by PCR using gene-specific primers. The gene is expressed at highest levels in the testis.
• Testicular acid phosphatase gene expression in testicular tumors In order to investigate the possible differential expression of the testicular acid phosphatase gene in testicular tumors, 14 pairs of matched cancerous/normal tissues of testicular tumors, including six seminomas, and 8 non-seminomas (teratoma, embryonal carcinoma, and choriocarcinoma) were studied. cDNAs from these tissues were examined by PCR using gene-specific primers.
• testicular acid phosphatase gene was found to be abundantly expressed in all 14 normal testicular tissues. Expression was very low or undetectable in 10 out the 14 cancerous counterparts, lower than normal in 2 tumors, and comparable to normal in another two ( Figure 8). Actin, a housekeeping gene, was used as a control, and approximately the same level of expression for the latter was found in all normal and malignant tissues, indicating that the lower level of testicular acid phosphatase expression was not due to mRNA variation between samples. Splice variants of the testicular acid phosphatase gene
• PCR screening using gene-specific primers revealed the presence of up to 3 closely spaced bands in some of the tissue cDNAs (Figure 6). These bands were digested by 2 different restriction enzymes (to allow better separation), gel purified, cloned and sequenced. The middle band represents the regular form of the gene, the upper band represents splice variant 1, and the lower band splice variant 2. ( Figure 9). Another short splice variant was identified in the bone marrow (splice variant 3) (data not shown). Splice variant 1 is present in the testis, trachea, prostate and bone marrow.
• the first intron is not spliced out, thus, exons 1 and 2 and the intervening intron are all parts of the first exon. This leads to frame shifting.
• the mRNA is predicted to encode for a truncated protein of 92 amino acids.
• Splice variant 2 has the same structure as variant 1 in addition to a deleted exon 7.
• Splice variant 3 is similar to the regular form but is missing exons 4 and 5 and the last part of exon 3. This variant is predicted to encode for a polypeptide chain of 333 amino acids. Chromosomal localization of the testicular acid phosphatase gene
• PCR screening of the BAC clone was performed using gene-specific primers for the testicular acid phosphatase gene and each one of the 15 kallikrein genes that were recently cloned in this region (17,31).
• the clone was positive to KLK15, and KLK1, and testicular acid phosphatase, but negative for KLK3 (PSA) and other kallikreins.
• testicular acid phosphatase gene is the most centromeric, and transcribes from centromere to telomere.
• KLK1 and KLK15 genes are transcribed in the opposite direction.
• the KLK3 gene (coding for prostate specific antigen) is the most telomeric and is transcribed in the same direction as the testicular acid phosphatase gene .
• a detailed map of the region, showing distances between these four genes and BAC clones is shown in Figure 10. No other genes were found to map between the ACPT and KLK1 genes. Discussion
• Acid phosphatase (EC 3.1.3.2) is represented by a number of enzymes that can be differentiated according to structural, catalytic and immunological properties (32).
• the structural features of the newly identified testicular acid phosphatase gene are quite similar to those of the prostatic and lysosomal acid phosphatase genes at both the DNA and protein levels.
• the genomic level the following structural features are conserved in all three genes: a) the numbers of exons are similar (except for the lack of exon 11, that contains the transmembrane domain, in prostatic acid phosphatase).
• the lengths of all exons are comparable or identical (except exon 11 of ACP2) .
• the intron phases are conserved in all three genes (except for exon 7 in ACPP).
• all exon/intron boundaries follow the GT/AG rule (except for exon 3 in ACPP). Table 2 summarizes various structural features of the three genes.
• testicular acid phosphatase With the prostatic and lysosomal acid phosphatases ( Figure 2) indicates the presence of a high degree of homology ( ⁇ 50%), and the existence of many conserved domains. Furthermore, the positions of six cysteine residues are completely conserved in all 3 proteins ( Figure 2). Transmembrane prediction programs indicated that the testicular acid phosphatase protein contains a short cytoplasmic domain, a transmembrane domain, and a long luminal (extracellular) domain ( Figure 4). This pattern is quite similar to that of the human, rat and mouse lysosomal acid phosphatases, and the positions of these three domains are nearly identical (33).
• testicular acid phosphatase gene was found to be up-regulated by androgens, and down-regulated by estrogen (Figure 7).
• phylogenetic analysis indicated that ACPT is more closely related to ACPP and ACP2 proteins, and to a lesser degree with other acid phosphatases (Figure 5).
• the newly identified testicular acid phosphatase gene should be considered to encode for an acid phosphatase based on structural and protein similarities.
• the length of the signal peptide (28 amino acids) is comparable to that of prostatic and lysosomal acid phosphatases (32 and 30 amino acids, respectively), and the predicted cleavage site occurs at a similar position in all three genes ( Figure 2).
• the testicular acid phosphatase gene is up-regulated by androgens and is down-regulated by estrogens in the LNCaP prostate cancer cell line.
• the two available tumor markers for prostate cancer, PSA and ACPP were also shown to be up-regulated by androgens in prostate cells (1,2,9,39).
• Testicular cancer is the most common malignancy in men aged 15-34 years, and its incidence has increased over the past 35 years (40,41).
• Testicular germ cell neoplasms originate from germ cells, and proceed through a pre-malignant carcinoma in situ (CIS) stage. Time for progression from CIS to invasive tumor is roughly 5 years (42).
• Testicular germ cell tumors exhibit non-random loss of DNA sequences scattered among several distinct chromosomal arms (43), suggesting that loss of tumor suppressor genes contribute to progression from CIS.
• a unique feature of testicular tumors is that they are "curable", i.e., they are extremely sensitive to chemotherapy (42), and early diagnosis of the disease by a reliable tumor marker is of extreme importance.
• Testicular cancer is one of the hormonally related cancers (44).
• the role of steroid hormones in the development of testicular cancer is not clear but two recent reports suggest that one possible cause of testicular cancer may be suboptimal androgen levels (45) and environmental estrogen exposure (40).
• One possible mechanism of action of these hormones is through altering the expression of hormonally regulated genes.
• Testicular acid phosphatase is one potential candidate gene.
• Table 1 EST clones with >97% homology to exons of the testicular acid phosphatase gene.

Priority Applications (1)

Applications Claiming Priority (2)

Publications (2)

Family

ID=23013809

Family Applications (1)

Country Status (2)

Cited By (2)

Citations (2)

Family Cites Families (1)

• 2002
  • 2002-02-01 WO PCT/CA2002/000105 patent/WO2002063013A2/en not_active Application Discontinuation
  • 2002-02-01 AU AU2002229440A patent/AU2002229440A1/en not_active Abandoned

Patent Citations (2)

Non-Patent Citations (6)

Also Published As

Similar Documents

Legal Events