US20080249029A1 - Methods for Treating Skin Pigmentation - Google Patents

Methods for Treating Skin Pigmentation Download PDF

Info

Publication number
US20080249029A1
US20080249029A1 US11/929,488 US92948807A US2008249029A1 US 20080249029 A1 US20080249029 A1 US 20080249029A1 US 92948807 A US92948807 A US 92948807A US 2008249029 A1 US2008249029 A1 US 2008249029A1
Authority
US
United States
Prior art keywords
alkyl
amino
substituted
carboxy
hydroxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/929,488
Inventor
Stanley S. Shapiro
Miri Seiberg
Susan Niemiec
John Kung
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27368528&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20080249029(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Individual filed Critical Individual
Priority to US11/929,488 priority Critical patent/US20080249029A1/en
Publication of US20080249029A1 publication Critical patent/US20080249029A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/40Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
    • A61K8/44Aminocarboxylic acids or derivatives thereof, e.g. aminocarboxylic acids containing sulfur; Salts; Esters or N-acylated derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/40Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/02Cosmetics or similar toiletry preparations characterised by special physical form
    • A61K8/14Liposomes; Vesicles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/40Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
    • A61K8/41Amines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/40Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
    • A61K8/42Amides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/46Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing sulfur
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/49Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
    • A61K8/4906Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with one nitrogen as the only hetero atom
    • A61K8/4926Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with one nitrogen as the only hetero atom having six membered rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/67Vitamins
    • A61K8/676Ascorbic acid, i.e. vitamin C
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/67Vitamins
    • A61K8/678Tocopherol, i.e. vitamin E
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9789Magnoliopsida [dicotyledons]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9794Liliopsida [monocotyledons]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/16Emollients or protectives, e.g. against radiation
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/02Preparations for care of the skin for chemically bleaching or whitening the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/04Preparations for care of the skin for chemically tanning the skin

Definitions

  • This invention is related to methods and compositions for bringing about skin pigmentation and/or for causing skin depigmentation. More particularly, this invention relates to compounds which affect melanogenesis and can be used as depigmenting agents or as agents for darkening skin.
  • Skin coloring has been of concern to human beings for many years.
  • the ability to remove hyperpigmentation, such as found in age spots, freckles or aging skin generally, is of interest to individuals desiring a uniform complexion. In certain areas of the world, general body whitening is desirable. There are also hypopigmentation and hyperpigmentation disorders that are desirable to treat.
  • the ability to generate a tanned appearance without incurring photodamage due to solar radiation is important to many individuals.
  • There have been many methods proposed to accomplish depigmentation, as well as to accomplish darkening of the skin For example, kojic acid, hydroguinone, retinoids and other chemical compounds have been used for depigmentation. Dihydroxyacetone and like chemical compounds have been utilized for their ability to “tan” the skin without exposure to the sun.
  • TRP-1 is the most abundant glycoprotein in melanocytes.
  • Tyrosinase and the TRP's share structural and biological properties with the lysosomal-associated membrane protein (LAMP) gene family, therefore their targeting to the melanosomal membrane might induce their activation.
  • LAMP lysosomal-associated membrane protein
  • a phosphorylation/dephosphorylation reaction at the cytoplasmic tails of these proteins could be involved in the regulation of melanogenesis.
  • the beta isoform of the Protein Kinase C(PKC) family has been shown to regulate human melonogenesis through tyrosinase activation. Gene expression of tyrosinase, TRP-1 and TRP-2 is coordinated.
  • All three enyzmes are expressed in human epidermis. In melanocytes co-cultured with keratinocytes, these transcripts are expressed at a ratio of 45:45:10, respectively. In melanocytes cultured alone, only TRP-1 transcripts are present, indicating that a keratinocyte-derived signal is involved in the coordinate expression of these genes. The regulation of keratinocyte-melanocyte interactions and the mechanism of melanosome transfer into keratinocytes are not yet understood.
  • the Protease-activated receptor-2 (PAR-2) is a seven transmembrane G-protein-coupled receptor, that is related to, but distinct from the thrombin receptors (TR, also named PAR-1, and PAR-3) in its sequence. Both receptors are activated proteolytically by an arginine-serine cleavage at the extracellular domain. The newly created N-termini then activate these receptors as tethered ligands. Both receptors could be activated by trypsin, but only the TRs are activated by thrombin. Only PAR-2 is activated by mast cell tryptase. Both receptors could also be activated by the peptides that correspond to their new N-termini, independent of receptor cleavage.
  • SLIGRL the mouse PAR-2 activating peptide
  • compositions of this invention may contain one or more compounds that act as trypsin, as tryptase, as serine protease or as PAR-2 agonists, for increase in pigmentation.
  • they may contain one or more compounds that act as serine protease inhibitors, trypsin inhibitors, thrombin inhibitors, tryptase inhibitors, as PAR-2 pathway inhibitors or as a PAR-2 antagonist for decrease in pigmentation, or “depigmentation”.
  • mammal means any member “of the higher vertebrate animals comprising the class “Mammalia”, as defined in Webster's Medical Desk Dictionary 407 (1986), and includes but is not limited to humans.
  • receptor shall include both intracellullar and extracellular receptors and shall mean those molecules capable of receiving and transducing a signal.
  • PAR-2 refers to the protease-activated receptor-2 or a related protease activated receptor.
  • the Protease-activated receptor-2 (hereinafter, “PAR-2”) is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes and fibroblasts.
  • the thrombin receptor also named PAR-1, hereinafter, “TR” is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes.
  • the biological roles of PAR-2 and TR in skin are not entirely known. However, we have found that interactions between keratinocytes and melanocytes, via the PAR-2 pathway, affect melanogenesis.
  • thrombin inhibitors, and/or tryptase inhibitors, and/or trypsin inhibitors and PAR antagonists can be used as depigmenting agents without irritation of the skin.
  • PAR-2 agonists and serine proteases such as trypsin and tryptase can be used as darkening agents.
  • PAR-2 could be useful as a target for whitening and darkening agents.
  • FIG. 1A is a graph depicting the increase or decrease in relative pigmentation of epidermal equivalents containing melanocytes treated with known pigmenting and depigmenting agents in accordance with the methods of this invention.
  • FIG. 1B is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention.
  • FIG. 2 is a group of images of epidermal equivalents containing melanocytes treated with PAR-2 agonists and Compound I.
  • FIG. 3 is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention.
  • FIG. 4A is a graph depicting the dose/response with respect to pigmentation in epidermal equivalents containing melanocytes when treated with compositions of this invention.
  • FIG. 4B is a graph depicting the response of epidermal equivalents containing melanocytes after exposure to ultraviolet light followed by treatment with compositions of this invention.
  • FIG. 5A is a photograph depicting gels showing the expression of TR and PAR-2 in skin, melanoma cells and epidermal equivalents containing melanocytes.
  • FIG. 5B is a photograph depicting gels showing the expression of TR and PAR-2 by primary human melanocytes.
  • FIGS. 6A and 6B are photographs depicting gels showing the expression of various genes after treatment with different concentrations of Compound I and SLIGRL.
  • FIG. 7 is a graph showing the effects of different compositions of this invention on the brightness of guinea pig nipple pigmentation.
  • FIG. 8 is a photograph of Yucatan Swine skin which has been treated with compositions of this invention for depigmentation of skin.
  • FIG. 9 is a graph depicting the brightness of Yucatan Swine skin during the course of treatment in accordance with the methods and compositions of this invention.
  • FIGS. 10A , 10 B, 10 C and 10 D are photographs of F&M stained histological sections of Yucatan Swine skin treated with compositions containing Compound I in accordance with methods of this invention at concentrations of 0, 10 ⁇ M, 50 ⁇ M and 250 ⁇ M respectively.
  • FIGS. 11A , 11 B and 11 C are photographs of electron micrographic views of epidermal equivalents containing melanocytes treated with compositions of this invention.
  • FIGS. 11E , 11 F and 11 H are photographs of electron micrographic views of Yucatan Swine skin treated with compositions of this invention.
  • FIGS. 11D and 11G are photographs of electron micrographic views of untreated sites of Yucatan Swine skin.
  • FIGS. 12A , 12 B, 12 C, 12 D and 12 E are photographs of histological F&M stained sections of Yucatan Swine skin, as follows: 12 A shows untreated skin; 12 B shows skin treated with compositions of this invention after eight weeks of treatment; 12 C shows skin one week after stopping treatment; 12 D shows skin two weeks after stopping treatment and 12 E shows skin four weeks after stopping treatment.
  • FIG. 13 is a photograph of F&M stained histological sections taken from Yucatan Swine skin treated with compositions of this invention.
  • FIG. 14 contains ultraviolet and visible light digital photographs of human skin prior to treatment and subsequent to treatment with compositions of this invention.
  • trypsin, tryptase and PAR-2 agonists can be used to increase pigmentation and that trypsin inhibitors, and/or tryptase inhibitors, and/or thrombin inhibitors and PAR-2 antagonists act to decrease pigmentation in mammalian skin.
  • trypsin inhibitors, and/or tryptase inhibitors, and/or thrombin inhibitors and PAR-2 antagonists act to decrease pigmentation in mammalian skin.
  • some of the compounds described in U.S. Pat. No. 5,523,308, which is hereby incorporated herein by reference, and behave as thrombin and/or trypsin and/or tryptase inhibitors will be useful in methods of this invention.
  • A is selected from the group consisting of C 1-8 alkyl, carboxyC 1-4 alkyl,
  • amino terminus of said amino acid is connected to a member selected form the group consisting of C 1-4 alkyl, tetrazol-5-yl-C 1-2 alkyl, carboxytC 1-4 alkyl, C 1-4 alkoxycarbonylC 1-4 alkyl, phenylC 1-4 alkyl, substituted phenyl C 1-4 alkyl (where the phenyl substituents are independently selected from one or more of, C 1-4 alkyl, perfluoroC 1-4 alkyl, C 1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C 1-4 alkylamino, C 1-4 dialkylamino, carboy or C 1-4 alkoxycarbonyl), 1,1-diphenylC 1-4 alkyl, 3-phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyethylcarbonyl, [1,2,3,4]-tetrahydroisoquinoline-1-carbonyl, [1,2,3,4]
  • the first amino acid is a D or L amino acid, bound via its carboxy terminus tot he nitrogen depicted in Formula I and is selected from the group consisting of glycine, N—C 1-8 alkylglycine, alanine, 2-azetidinecarboxylic acid, proline, thiazolidine-4-carboxylic acid, 5.5-dimethylthiazolidine-4-carboxylic acid, oxazolidine-4-carboxylic acid, 1-amino-1-cycloC 3-8 alkylcarboxylic acid, 3-hydroxypropoline, 4-hydroxyproline, 3-(C 1-4 alkoxy)proline, 4(C 1-4 alkoxy)proline, 3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid, 2.2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid, valine, methionine, cysteine, asparagine, serine, threonine, le
  • p is 0 or 1;
  • n is 0-3, R 3 is H or C 1-5 alkyl and the carbonyl moiety of B is bound to E;
  • E is a heterocycle selected from the group consisting of oxazolin-2-yl, oxazol-2-yl, thiazol-2-yl, thiazol-5-yl, thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl, 4-oxo-2-quinoxalin-2yl, 2-pyridyl, 3-pyridyl, benzo[b]thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl, 4,5,6,7-tetrahydrobenzothiazol-2-yl, naphtho[2,1-d]thiazol-2-yl, naphtho[1-2-d]thiazol-2-yl quinoxalin-2-yl, isoquinolin-1-yl, isoquinolin-3-yl, benzo[b]furan-2-yl, [pyrazin-2-yl, quinazol
  • serine protease inhibitors may be extracted from the species belonging to the following plant families: Solanaceae (e.g., potato, tomato, tomatlla, and the like); Gramineae (e.g., rice, buckwheat, sorghum, wheat, barley, oats and the like); Cucurbitaceae (e.g., cucumbers, squash, gourd, luffa and the like); and, preferably, Leguminosae (e.g., beans, peas, lentils, peanuts, and the like).
  • Solanaceae e.g., potato, tomato, tomatlla, and the like
  • Gramineae e.g., rice, buckwheat, sorghum, wheat, barley, oats and the like
  • Cucurbitaceae e.g., cucumbers, squash, gourd, luffa and the like
  • Leguminosae e.g., beans, peas
  • the compounds capable of affecting the pigmentation of the skin do so by interacting directly or indirectly with the keratinocyte PAR-2 or with its activating protease, and thereby affect melanogenesis, directly or indirectly.
  • the compounds of this invention induce, in the case of increased pigmentation or reduce, in the case of decreased pigmentation, the signal to transport melanosomes by melanocytes, or to receive melanosomes by keratinocytes in the skin.
  • the compounds which are active in the compositions and methods of this invention may be delivered topically by any means known to those of skill in the art. If the delivery parameters of the topically active pharmaceutical or cosmetic agent so require, the topically active composition of this invention may preferably be further composed of a pharmaceutically or cosmetically acceptable vehicle capable of functioning as a delivery system to enable the penetration of the topically active agent into the skin.
  • One acceptable vehicle for topical delivery of some of the compositions of this invention may contain liposomes.
  • the liposomes are more preferably none ionic and contain a) glycerol dilaurate (preferably in an amount of between about 5% and about 70% by weight); b) compounds having the steroid backbone found in cholesterol (preferably in an amount of between about 5% and about 45% by weight); and c) one or more fatty acid ethers having from about 12 to about 18 carbon atoms (preferably in an amount of between about 5% and about 70% by weight collectively), wherein the constituent compounds of the liposomes are preferably in a ratio of about 37.5:12.5:33.3:16.7.
  • Liposomes comprised of glycerol dilaurate/cholesterol/polyoxyethylene-10-stearyl ether/polyoxyethylene-9-lauryl ether (GDL liposomes) are most preferred.
  • the liposomes are present in an amount, based upon the total volume of the composition, of from about 10 mg/mL to about 100 mg/mL, and more preferably from about 20 mg/mL to about 50 mg/mL. A ratio of about 37.5:12.5:33.3:16.7 is most preferred.
  • Suitable liposomes may preferably be prepared in accordance with the protocol set forth in Example 1, though other methods commonly used in the art are also acceptable.
  • compositions of this invention may be prepared by combining the desired components in a suitable container and mixing them under ambient conditions in any conventional high shear mixing means well known in the art for non-ionic liposomes preparations, such as those disclosed in Niemiec et al., “Influence of Nonionic Liposomal composition On Topical Delivery of Peptide Drugs Into Pilosebacious units: An In Vivo Study Using the Hamster Ear Model,” 12 Pharm. Res. 1184-88 (1995) (“Niemiec”), which is incorporated by reference herein in its entirety. We have found that the presence of these liposomes in the compositions of this invention may enhance the depigmenting capabilities of some of the compositions of this invention.
  • Other preferable formulations may contain, for example, soybean milk or other liquid formulations derived directly from legumes or other suitable plant.
  • a formulation may contain a large proportion of soybean milk, an emulsifier that maintains the physical stability of the soybean milk, and, optionally a chelating agent, preservatives, emollients, humectants and/or thickeners or gelling agents.
  • Oil-in-water emulsions, water-in-oil emulsions, solvent-based formulations and aqueous gels known to those of skill in the art may also be utilized as vehicles for the delivery of the compositions of this invention.
  • the source of active compound to be formulated will generally depend upon the particular form of the compound. Small organic molecules and peptidyl fragments can be chemically synthesized and provided in a pure form suitable for pharmaceutical/cosmetic usage. Products of natural extracts can be purified according to techniques known in the art. Recombinant sources of compounds are also available to those of ordinary skill in the art.
  • the topically active pharmaceutical or cosmetic composition may be optionally combined with other ingredients such as moisturizers, cosmetic adjuvants, anti-oxidants, bleaching agents, tyrosinase inhibitors and other known depigmentation agents, surfactants, foaming agents, conditioners, humectants, fragrances, viscosifiers, buffering agents, preservatives, sunscreens and the like.
  • the compositions of this invention may also contain active amounts of retinoids (i.e., compounds that bind to any members of the family of retinoid receptors), including, for example, tretinoin, retinol, esters of tretinoin and/or retinol and the like.
  • the topically active pharmaceutical or cosmetic composition should be applied in an amount effective to affect changes in the pigmentation of mammalian skin.
  • amount effective shall mean an amount sufficient to cover the region of skin surface where a change in pigmentation is desired.
  • the composition is liberally applied to the skin surface such that, based upon a square cm of skin surface, from about 2 ⁇ l/cm 2 to about 200 ⁇ l/cm 2 of topically active agent is present when a change in pigmentation is desired.
  • a thrombin and trypsin inhibitor such as compound I or its analogs, whether synthetically- or naturally-derived in a formulation, such an active compound should be present in the amount of from about 0.0001% to about 15% by weight/volume of the composition.
  • Liquid derivatives and natural extracts made directly from plants or botanical sources may be employed in the compositions of this invention in a concentration (w/v) from about 1 to about 99%.
  • Fractions of natural extracts and naturally-derived protease inhibitors such as STI may have a different preferred range, from about 0.01% to about 20% and, more preferably, from about 1% to about 10% of the composition.
  • mixtures of the active agents of this invention may be combined and used together in the same formulation, or in serial applications of different formulations.
  • topically active agents such as PAR-2 agonists and/or inhibitors and tryosin and/or thrombin and/or tryptase and/or their inhibitors
  • topically active agents such as PAR-2 agonists and/or inhibitors and tryosin and/or thrombin and/or tryptase and/or their inhibitors
  • depigmenting agents are applied to the skin of a mammal at a relatively high concentration and dose (from about 0.005% to about 1% for compounds having high therapeutic indices such as Compound I and related compounds; from about 20% to about 99% for liquid derivatives and extracts of botanical materials; and from about 1% to about 20% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof) between one and two times daily for a period of time until the skin evidences a change in pigmentation. This may be for from about four to about ten weeks or more.
  • a lower concentration and dose (from about 0.00001% to about 0.005% for compounds having high therapeutic indices such as Compound I and related compounds; from about 10% to about 90% for liquid derivatives and extracts of botanical materials; and from about 0.01% to about 5% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof), of active ingredient may be applied on a less frequent time schedule, e.g., about once per day to about twice per week.
  • the effects of the active agents of this invention are reversible, therefore, in order to maintain these effects, continuous application or administration should be performed.
  • the invention illustratively disclosed herein suitably may be practiced in the absence of any component, ingredient, or step which is not specifically disclosed herein.
  • the epidermal equivalent system used contained melanocytes.
  • One epidermal equivalent system which is useful in performing this study is the MelanoDerm system, available commercially from MatTek Co. This system contains human normal melanocytes, together with normal, human-derived epidermal keratinocytes, which have been cultured to form a multi layered, highly differentiated model of the human epidermis.
  • equivalents were treated with test compounds for three days and samples were harvested on the fourth day after beginning of treatment.
  • the harvested equivalents were stained with DOPA (a substrate for tyrosinase) and H&E (a standard histological stain) or with Fontana-Mason (F&M) staining, another stain known to those of skill in the art.
  • F&M staining is a silver staining technique that clearly and cleanly marks melanins which have high silver nitrate reducing activity.
  • Multilayered human epidermal equivalents containing melanocytes were used as an in vitro model system to study the effect of protease inhibitors on melanogenesis.
  • Epidermal equivalents used were commercially available as MelanoDerm from MatTek of Ashland, Mass. These equivalents are known to respond to ultraviolet B (“UVB”) irradiation and known whitening agents such as benzaldehyde and hydroquinone by increasing and reducing pigmentation, respectively.
  • UVB ultraviolet B
  • the MelanoDerm epidermal equivalents were exposed to benzaldehyde (available from Sigma of St. Louis, Mo.), hydroquinone (available from Sigma) and UVB irradiation.
  • UV irradiation was performed with a UVB FS light source in an exposure chamber, with plate covers removed and Phosphate-buffered saline (PBS, from Gibco-BRL, Gaithersburg, Md.) present in the lower chamber. UVB intensity was measured with a UVX radiometer (UVP Inc., San Gabriel, Calif.). Equivalents were treated with 0.1-0.12 J/cm 2 No loss of viability was observed in equivalents treated with up to 0.3 J/cm 2 .
  • PBS Phosphate-buffered saline
  • F&M identifies silver nitrate reducing molecules, which identifies primarily melanins. F&M stained sections were used for image analysis using Optomax Image Analysis Systems, from Optomax Inc., Hollis, N.H. Alternatively, Empire Images database 1.1 was used on a Gateway 2000 PS-100 computer (Media Cybernetics, Silver Springs, Md.) for capturing images. Image Pro Plus version 4.0 was used for image analysis. Parameters measured were as follows: (1) level of pigmentation within individual melanocytes and (2) number of pigmented melanocytes per field, for the Optomax system, or (1) the surface area of silver deposits within melanocytes and (2) the number of pigmented melanocytes for the Image Pro system.
  • FIG. 1A is a graph depicting the increase or decrease in relative pigmentation, as measured and calculated by the whole equivalent/Image Pro system, as set forth above, when exposed to benzaldehyde (500M), hydroquinone (50 M) and UVB irradiation (0.12 J/cm 2 ).
  • protease inhibitors were also exposed to mixtures of protease inhibitors, said protease inhibitors are set forth in Table A below.
  • the protease inhibitors were available from Boehringer Mansheim of Indianapolis, Ind. Complete® Protease Inhibitor Cocktail tablets available from Boehringer Mannheim were used, containing inhibitors of chymotrypsin, thermolysin, papain, pronase, pancreatic extract and trypsin.
  • Soybean trypsin inhibitor (“STI”) was available from Sigma and was dissolved in a 50 mg/ml liposome vehicle or in 1 ⁇ PBS. All other protease inhibitors used in this in vitro example were dissolved in 1 ⁇ PBS.
  • GDL liposomes were prepared as set forth in Niemic, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van Dyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes.
  • a Protease-Activated Receptor is Involved in Pigmentation
  • Example 1 demonstrates that STI reduces pigmentation.
  • STI inhibits trypsin. Because trypsin is known to activate TR and PAR-2, we tested the possible involvement of TR and PAR-2 in pigmentation.
  • MelanoDerm human epidermal equivalents were treated with the TR and PAR-2 agonists and antagonists set forth in Table B below daily for three days. On the fourth day, the samples were harvested, fixed, and DOPA, H&E or F&M staining was performed. Histological and whole-equivalent examination revealed changes in pigmentation following the treatments.
  • FIG. 2 depicts the results of this example. As shown therein, the PAR-2 peptide agonist SLIGRL induced pigmentation in individual melanocytes. Treatment with Compound I, an inhibitor of thrombin and trypsin, resulted in decreased pigmentation.
  • FIG. 3 shows the results of the studies set forth in this example, representing the level of pigmentation in MelanoDerm equivalents treated with TR and PAR-2 reagents.
  • SLIGRL a PAR-2 agonist
  • Hirudin, a thrombin-specific inhibitor, and TFLLRNPNDK a TR selective agonist had no effect on pigmentation.
  • SFLLRN a less specific TR agonists, showed a trend of lightening or reducing pigmentation. This indicates that TR is less likely to be involved in pigmentation.
  • TR Trypsin Activates TR and PAR-2 TFLLRNPHDK TR peptide agonist - activates TR only SLIGRL PAR-2 peptide agonist - activates PAR-2 o SFLLRN TR peptide agonist - activates TR, cross-reacts with PAR-2 FSLLRN Scrambled peptide - inactive Hirudin Specific inhibitor of thrombin Compound I Thrombin and trypsin inhibitor
  • PAR-2 and TR expression have been demonstrated previously in keratinocytes and fibroblasts. This example demonstrates that PAR-2 is expressed in keratinocytes, but not in melanocytes. Furthermore, it demonstrates that TR is expressed in both keratinocytes and melanocytes.
  • RNA Stat-60 reagent available from “Tel-Test B”, Incorporated as described in Chomczymski, “Single Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-phenol-chloroform extraction,” 162 Anal. Biochem. 156-69 (1987).
  • RNase-free DNase available from Promega Corporation under the tradename “RQ1 RNase-free DNase” was then added to the extracted RNA from each sample such that each respective product will yield 200 ng of DNased-RNA using the procedure set forth in “RNase-free DNase”, protocol published by Promega Corporation (May, 1995).
  • the resulting 200 ng of DNased-RNA was reverse transcribed (“RT”) via the procedure set forth in “Superscript II Reverse Transcriptase” a protocol published by Gibco-BRL (now Life Technologies, Incorporated) (April 1992), using random hexamers such as the random primers which are commercially available from Life Technologies, Incorporated.
  • RT products were then amplified via polymerase chain reaction (“PCR”) using about a 0.5 unit (per 100 ⁇ l reaction) of a thermostable DNA polymerase which is commercially available from Perkin-Elmer-Cetus Corporation under the tradename “Taq polymerase” and about 0.1 ⁇ mol/reaction of TR and PAR-2 specific primers as described in Table C and in Marthinuss et al., 1995 which is hereby incorporated herein by reference or of glyceraldehyde-3-phosphate-dehydrogenase (G3PDH) primers, available from Clontech Laboratories, Inc. of Palo Alto, Calif. in accordance with the procedures set forth in Marthinuss et al., 1995 or in the protocol accompanying the primers from Clontech Laboratories.
  • PCR polymerase chain reaction
  • PCR products were then analyzed using 2% agarose/ethidium bromide gels according to methods well-known in the art in order to compare the level of expression of certain genes in keratinocytes and melanocytes. When necessary for better visualization, the resulting PCR products were precipitated with ethanol according to well-known procedures. When primers for G3PDH were used, only 10% of the PCR reaction products were used. An RNA sample from epidermal equivalents that was not reverse-transcribed was used as a negative control for each PCR amplification. The lack of genomic DNA contaminants was indicated by the lack of a band on the relevant lanes in the gels. A human skin RNA sample which was reverse-transcribed was used as a positive control when commercial positive controls were not available. The migration of the RT-PCR products on the gels was always identical to that of the positive controls, and to that of the reported amplimer sizes.
  • FIG. 5A shows that, as expected, TR and PAR-2 are expressed in total skin and in the MelanoDerm equivalents (“MD”). However, S91 melanoma cells (“S91”) did not express PAR-2 or TR. To investigate this further, we tested primary newborn (“mel-NB”) and adult (“mel-A”) melanocytes for TR and PAR-2 expression. As shown in FIG. 5B , primary human melanocytes express TR but not PAR-2. Therefore, we suggest that PAR-2 agonists and antagonists can interact with keratinocytes, but not with melanocytes, in the MelanoDerm equivalents, and that TR agonists and antagonists could interact with both keratinocytes and melanocytes. A keratinocyte-melanocyte interaction is, therefore, suggested, during which the keratinocyte-PAR-2 signal is converted into a pigmentation end point.
  • Table C illustrates some of the DNA primers used, the amount of MgCl 2 required for the PCR reaction, and the length of the PCR cycle.
  • Example 4 suggest that melanocytes alone might not respond to the depigmenting effect of PAP-2 antagonists. Indeed, the level of pigmentation of human primary melanocytes or choleratoxin-induced S91 cells, which is reduced by hydroquinone and benzaldehyde, was not affected by Compound I.
  • keratinocytes are indicated by “K”
  • melanocytes are indicated by “M”
  • lack of keratinocyte-melanocyte contact is indicated as “no K-M contact”.
  • no effect on pigmentation was observed in primary melanocytes and in co-cultures treated with these agents.
  • compound I reduced and SLIGRL induced pigmentation, while TFLLRNPNDK had no effect.
  • RNAs extracted from untreated and Compound I-treated equivalents were analyzed for gene expression by RT-PCR in the manner set forth above in Example 4.
  • Gene-specific primers were designed as set forth in Table C above, and Clontech primers for human G3PDH were used as in Example 4.
  • Melanogenic genes tested for expression level were tyrosinase, TRP-1, and TRP-2.
  • TRP-2 enzyme processes dopaquinone to 5,6-dihydroxyindole carboxylic acid (DHICA), rather than to 5,6-dihydroxyindole (DHI). This process results in brown, finely dispersed eumelanin, as opposed to insoluble black eumelanin, and results in a lighter skin tone.
  • DHICA 5,6-dihydroxyindole carboxylic acid
  • DHI 5,6-dihydroxyindole
  • TRP-1 stabilizes the melanogenic complex, enabling pigment production.
  • Reduced levels of TRP-1 result in reduced tyrosinase activity and reduced pigmentation. Lack of this protein results in albinism.
  • Increasing concentrations of SLIGRL did not affect melanogenic gene expression ( FIG. 6B ).
  • TRP-1 and TRP-2 are melanocyte-specific.
  • Compound I inhibits trypsin and thrombin.
  • Hirudin a specific thrombin inhibitor, had no effect on pigmentation, as seen above in Example 2.
  • a probe designed to detect both brain and gastric trypsins as described in Table C, detected the expression of both mRNAs in a total skin mRNA sample available from Invitrogen of Carlsbad, Calif., as well as in MelanoDerm equivalents. The same expression pattern was detected for thrombin. Both trypsin and thrombin were not expressed in normal melanocytes ( FIGS. 5A , B).
  • Two guinea pigs were treated twice daily, five days/week for seven weeks with Compound I at 1 and 10 ⁇ M in 70:30 ethanol:propylene glycol vehicle on one pigmented nipple.
  • the other nipple of each animal was treated with vehicle only and served as a control.
  • Chromameter measurement after seven weeks of treatment revealed a dose-dependent lightening effect of +9.6 L* and nearly 18 L* units respectively. No visible signs of irritation were observed at that time.
  • a Yucatan mitroswine was treated with Compound I, SFLLRN, FSLLRN and SLIGRL at 10 ⁇ M. Each compound was applied to two sites on the pig twice daily, five days per week for eight weeks. After eight weeks of treatment, chromameter measurements were taken. The application of Compound T resulted in a visible lightening effect. The PAR-2 agonist SLIGRL resulted in a darkening effect as measured by chromameter. SFLLRN and FSLLRN had no significant effects.
  • Two Yucatan swine were treated for seven and a half weeks, or for ten weeks, twice daily, five days per week, with increasing concentrations of Compound I.
  • Four concentrations of active compound were used, as follows: 0, 10, 50 and 250 ⁇ M.
  • Two sites per concentration were placed on opposite sides of the swine dorsum. Chromameter measurements were taken before treatment started and every two weeks thereafter. Pictures were taken periodically and at the end of the experiment. A visible lightening effect was observed during the 4th, 5th and 6th weeks of treatment, for the 250, 50 and 10 ⁇ M treatments, respectively.
  • the eighth week the whitening effect of the two highest doses was similar.
  • the chromameter readings (L*, measuring brightness) during the treatment course of one swine are shown in FIG. 9 .
  • a saturation effect is observed, which is a time and concentration dependent.
  • This example demonstrates a visual depigmenting effect by Compound I, in the animal model system most resemble pigmented human skin.
  • a Yucatan swine was treated with Compound 1,250-M, for eight weeks, twice daily, five days a week, on eight sites. All sites showed visible depigmentation by the end of the treatment period, as set forth in FIG. 12B .
  • the color of the treated sites was monitored, and two biopsies were taken each week from two treated sites. Untreated sites were biopsied as well. The depigmenting effect could be visualized at one and two weeks post treatment, and a complete reversal was observed by the forth week. Histological examination of F&M stained skin sections confirmed the repigmentation observed visually (as indicated in FIG. 12 ).
  • FIG. 12A shows two histological F&M stained sections of sites which were not treated with Compound I.
  • FIG. 12B shows two histological F&M stained sections of sites which were treated with Compound I for eight weeks.
  • FIG. 12C shows sections of sites which were treated for eight weeks with Compound I, one week after treatment was stopped.
  • FIG. 12D shows sections of sites which were treated for eight weeks with Compound I, two weeks after treatment was stopped.
  • FIG. 123 shows sections of sites which were treated for eight weeks with Compound I, four weeks after treatment was stopped.
  • the sections were fully repigmented four weeks after the end of treatment.
  • Example 1 demonstrates that the presence of soybean trypsin inhibitor in any lightening formulation is desirable for its depigmenting activity. Based on analytical testing, it has been determined that soybean milk and soybean paste are rich sources of soybean trypsin inhibitor.
  • soybeans were first soaked in deionized or purified water for several hours. The soybeans were ground after they were fully hydrated, with the addition of small quantities of water, if needed, to smoothen the paste. To make soybean milk, the same procedure was performed with the addition of more water. (The grinding process allows the soybean milk to be extracted). After collection, the soybean milk was filtered to remove any residual parts of the bean husk.
  • Soybean milk, soybean paste and miso were prepared to be used as naturally-derived materials that contain STI and are able to lighten skin color.
  • Two Yucatan swine were treated for eight and ten weeks, twice a day, five days a week, with different soybean- and lima-bean-derived products.
  • These natural products include soybean paste, soybean protein acid hydrolysate, misc, native and boiled soybean milk, and a commercially available extract of soybean (Actiphyte® of Active Organics, Dallas Tex.), as well as purified STI, and different preparations of trypsin inhibitors from soybeans and limabeans.
  • Actiphyte® of Active Organics, Dallas Tex. a commercially available extract of soybean
  • STI purified STI
  • An STI in Liposome Formulation can Lighten Human Age Spots
  • An individual with three age spots on the dorsum of their hand was treated for eight weeks, twice a day, with the following:
  • the age spot located closest to the arm was treated with placebo, containing 20 mg/ml of liposomes.
  • the middle age spot was not treated.
  • the third age spot was treated with STI, 1%, in liposomes (20 mg/ml).
  • GDL liposomes were prepared as set forth in Niemiec, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van tyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes. UV and visible light digital pictures were taken at time 0, 4 and 8 weeks of treatment. L* (brightness) values were calculated from the images using Adobe Photoshop.
  • FIG. 14 is a composite of four pictures.
  • the left panel is the visible light pictures of the hand, before (upper) and after (lower) 8 weeks of treatment.
  • the top age spot is the placebo-treated
  • the middle age spot is untreated
  • the lower age spot is the STI-treated.
  • the right panel shows the same hand at the same time points, using UV-photography. UV light enables the visualization of pigment deeper in the skin, demonstrating that the STI whitening effect was not superficial.
  • FIG. 14 clearly demonstrates that the STI formulation was able to lighten the lower age-spot. An increase of 15 L* units was calculated for this STI-treated site, further demonstrating the ability of this treatment to lighten age spots.
  • soybean milk In making the soybean milk, it was discovered that the rich emolliency of the milk would be desirable in a skin care formulation. Because water is used as the predominant ingredient of any oil-in-water emulsion, and in many other skin-care formulations we hypothesized that the soymilk could be used to substitute for the deionized water in such formulations. However, we expected that this type of formulation would not be physically stable due to the immiscibility of the oil and water components of the soybean milk. Surprisingly, we found that this substitution of soybean milk for water was physically stable. Formulations utilizing soybean milk should contain between about 1% and about 99% of soybean milk, more preferably from about 80% to about 95% soybean milk.
  • this and similar formulations should include a viscosity builder in an amount from about 0% to about 5% (more preferably, from about 0.1 to about 2%), one or more emollients in an amount up to about 20% and/or emulsifiers in an amount from about 0.1% to about 10% (more preferably from about 3 to about 5%), and, optionally, a spreading agent in an amount from about 0 to about 5% (more preferably from about 1 to about 2%), a preservative, a chelating agent or a humectant.
  • the preservative should be present in an effective amount in order to preserve integrity of the milk and maintain the composition's activity.
  • Sufficient thickener should be present to impart body to the formulation without causing it to become so viscous that it would hinder spreadability, e.g., from about 0 to about 10%, more preferably from about 3 to about 5%.
  • Sunscreen, antioxidants, vitamins other depigmenting agents and other skin care topical ingredients may also be incorporated into the compositions of this invention.
  • STI soybean paste and other trypsin inhibitor-containing natural extracts can be incorporated into such formulations to provide increasing concentrations of the serine protease inhibitor.
  • Use levels of the added active ingredient can range between 0.01% to 15% in a formulation.
  • Other depigmenting agents including PAR-2 inhibitors, tyrosinase inhibitors, hydroquinones, soy products, ascorbic acid and its derivatives, as well as other ingredients with skin care benefits could also be incorporated into this formulation.
  • Table F Two examples of a depigmenting formulation with oil-in-water emulsion are presented in Table F.
  • a formulation with STI where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 4 of Table F.
  • a similar formulation with Compound I is presented in column 5 of Table F.
  • Compound I in this composition could be replaced with similar compounds, or with serine protease inhibitors or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table F.
  • the deionized water content of these formulations could be replaced with soybean milk.
  • the ingredients of the lipid phase were combined and mixed at 85° C., and then cooled to 60° C.
  • the carbopol was slowly added to the water or to the soybean milk. After mixing for ten minutes the rest of the aqueous phase ingredients were added and the mix was heated to 60° C. The two phases were then combined, mixed for ten minutes, and cooled to room temperature.
  • one or more depigmentation agents may be combined within the same formulation, in this Example and in the following examples and other embodiments of the methods and compositions of this invention.
  • Table G Two additional examples of an oil-in-water emulsion depigmenting formulation are presented in Table G.
  • a formulation with STI where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 3 of Table G.
  • a similar formulation with Compound I is presented in column 4 of Table G.
  • Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table G.
  • the deionized water content of these formulations could be replaced with soybean milk.
  • the hydroxyethylcellulose was slowly added to the water or to the soybean milk and stir until completely dissolved.
  • the Acrylates/C10-30 Alkyl Acrylate Crosspolymer was added and stir until completely dissolved.
  • the content of the two containers was combined and mixed for 20 minutes Vitamin E acetate was then added and mixed, following by the addition of Isohexadecane and Panthenol (98%).
  • the STI, or the natural extract, or Compound I were added together with Propylene Glycol, and stirred for 5 minutes.
  • glycerine was added and the formulation was stirred for 20 minutes.
  • the pH was adjusted with sodium hydroxide to 8 for STI (range is 6-8.5) or to 7 for Compound I (range is 5.5-8.5).
  • Table H An example of a depigmenting formulation with water-in-oil emulsion is presented in Table H.
  • a formulation with STI where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 4 of Table H.
  • a similar formulation with Compound I is presented in column 5 of Table H.
  • Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table H.
  • the deionized water content of these formulations could be replaced with soybean milk.
  • Table J Two examples of a depigmenting formulation with aqueous gel are presented in Table J.
  • a similar formulation with Compound I is presented in column 4 of Table J.
  • Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table J.
  • the deionized water content of these formulations could be replaced with soybean milk.
  • Disodium EDTA, sodium metabisulfite and ascorbic acid were slowly added to the water or to the soybean milk and stir until completely dissolved.
  • STI, natural extracts or Compound I were then added and mixed slowly for five minutes. The speed of agitation was then increased and carbopol was added.
  • the composition was mixed for 30 minutes or until the dispersion was free of “fish eyes”, which are non-dispersed clear lumps, and heated to 50° C.
  • the slurry phase was prepared by combining Octoxynol-13,2,4-Hexadienoic acid, and Benzenemethanol and stirring ten minutes at 40-50° C.
  • the slurry was then added slowly to the aqueous phase, mixed, and cooled to 45° C. 20% sodium hydroxide solution was used to pH the composition to pH of 7.0 (range is 5.5-8.5). This was mixed to homogeneity using agitation or sweep vessel.
  • Table K An example of a depigmenting formulation containing solvent is presented in Table K.
  • a similar formulation with Compound I is presented in column 4 of Table K.
  • Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table K.
  • the deionized water content of these formulations could be replaced with soybean milk
  • activation of the keratinocyte receptor PAR-2 results in increased pigmentation.
  • activation may be accomplished by the use of trypsin or SLIGRL or SLIKOKVD or other SLTGRL or SLIGKVD derivatives.
  • whitening may be accomplished by the use of serine protease inhibitors or PAR-2 antagonists, as well as by melanosome-transfer blockers.
  • Other compounds known to those of skill in the art that inhibit melanosome transfer into keratinocytes could also be used as depigmenting agents.
  • Compound I a trypsin and thrombin inhibitor, for example, inhibits melanosome transfer to keratinocytes.
  • STI works by the same mechanism, The accumulation of undelivered melanosomes in the melanocytes could induce a negative feed back mechanism, that slows new melanosome formation.
  • the production of TRP-1 the major glycoprotein in melanocytes, is down-regulated, which leads to destabilization of tyrosinase. This results in reduced melanin formation, and in a color switch to a lighter brown, as the ratio of TRP-1:TRP-2 is reduced.
  • the melanosomes accumulation in the melanocyte after Compound I treatment, or after STI treatment therefore, have reduced and altered melanin content, which adds to the whitening effect of compound I or STI.

Abstract

This invention relates to methods and compositions for bringing about changes in skin pigmentation. More particularly, this invention relates to compounds which affect melanogenesis and can be used as depigmenting agents or as agents for darkening skin utilizing the PAR-2 pathway.

Description

    1. FIELD OF THE INVENTION
  • This invention is related to methods and compositions for bringing about skin pigmentation and/or for causing skin depigmentation. More particularly, this invention relates to compounds which affect melanogenesis and can be used as depigmenting agents or as agents for darkening skin.
  • 2. BACKGROUND OF THE INVENTION
  • Skin coloring has been of concern to human beings for many years. In particular, the ability to remove hyperpigmentation, such as found in age spots, freckles or aging skin generally, is of interest to individuals desiring a uniform complexion. In certain areas of the world, general body whitening is desirable. There are also hypopigmentation and hyperpigmentation disorders that are desirable to treat. Likewise, the ability to generate a tanned appearance without incurring photodamage due to solar radiation is important to many individuals. There have been many methods proposed to accomplish depigmentation, as well as to accomplish darkening of the skin. For example, kojic acid, hydroguinone, retinoids and other chemical compounds have been used for depigmentation. Dihydroxyacetone and like chemical compounds have been utilized for their ability to “tan” the skin without exposure to the sun.
  • Many of these previous solutions have not been found acceptable. There is often a distinct line of demarcation between the areas of skin to which such previous compositions have been applied. Therefore, precise application of all these compounds is necessary in order to achieve the desired result. Many of these compounds have been found to be quite irritating to the skin and therefore undesirable for use.
  • The understanding of the chemical and enzymatic basis of melanogenesis is heavily documented. Melanocytes migrate from the embryonal neural crest into the skin to produce secretory granules, melanosomes, which produce melanin. Melanogenesis occurs within the melanosome, and the melanin is later distributed to keratinocytes via the melanocyte dendrites. The key enzyme in melanogenesis is tyrosinase, which initiates a cascade of reactions which convert tyrosine to the biopolymer melanin. Two tyrosinase-related proteins (TRP's) are known, TRP-1 and TRP-2. These proteins share with tyrosinase about 40% homology and have catalytic activities as well as regulatory roles in melanogenesis. TRP-1 is the most abundant glycoprotein in melanocytes.
  • In spite of the fact that the chemical and enzymatic basis of melanogenesis is well-documented, its regulation at the cellular level is only partially understood. Tyrosinase and the TRP's share structural and biological properties with the lysosomal-associated membrane protein (LAMP) gene family, therefore their targeting to the melanosomal membrane might induce their activation. A phosphorylation/dephosphorylation reaction at the cytoplasmic tails of these proteins could be involved in the regulation of melanogenesis. The beta isoform of the Protein Kinase C(PKC) family has been shown to regulate human melonogenesis through tyrosinase activation. Gene expression of tyrosinase, TRP-1 and TRP-2 is coordinated. All three enyzmes are expressed in human epidermis. In melanocytes co-cultured with keratinocytes, these transcripts are expressed at a ratio of 45:45:10, respectively. In melanocytes cultured alone, only TRP-1 transcripts are present, indicating that a keratinocyte-derived signal is involved in the coordinate expression of these genes. The regulation of keratinocyte-melanocyte interactions and the mechanism of melanosome transfer into keratinocytes are not yet understood.
  • The Protease-activated receptor-2 (PAR-2) is a seven transmembrane G-protein-coupled receptor, that is related to, but distinct from the thrombin receptors (TR, also named PAR-1, and PAR-3) in its sequence. Both receptors are activated proteolytically by an arginine-serine cleavage at the extracellular domain. The newly created N-termini then activate these receptors as tethered ligands. Both receptors could be activated by trypsin, but only the TRs are activated by thrombin. Only PAR-2 is activated by mast cell tryptase. Both receptors could also be activated by the peptides that correspond to their new N-termini, independent of receptor cleavage. SLIGRL, the mouse PAR-2 activating peptide, is equipotent in the activation of the human receptor. While the function of the TR is well documented, the biology of the PAR-2 has not yet been fully identified. A role for PAR-2 activation in the inhibition of keratinocyte growth and differentiation has been recently described (Derian et al., “Differential Regulation of Human Keratinocyte Growth and Differentiation by a Novel Family of Protease-activate Receptors”, Cell Growth & Differentiation, Vol. 8, pp. 743-749, July 1997).
  • SUMMARY OF THE INVENTION
  • In accordance with this invention, we have found a method for affecting changes in mammalian skin pigmentation comprising topically applying to the skin of a mammal a compound which affects the PAR-2 pathway. The compositions of this invention may contain one or more compounds that act as trypsin, as tryptase, as serine protease or as PAR-2 agonists, for increase in pigmentation. Alternatively, they may contain one or more compounds that act as serine protease inhibitors, trypsin inhibitors, thrombin inhibitors, tryptase inhibitors, as PAR-2 pathway inhibitors or as a PAR-2 antagonist for decrease in pigmentation, or “depigmentation”.
  • As used herein, “mammal” means any member “of the higher vertebrate animals comprising the class “Mammalia”, as defined in Webster's Medical Desk Dictionary 407 (1986), and includes but is not limited to humans. As used herein, “receptor” shall include both intracellullar and extracellular receptors and shall mean those molecules capable of receiving and transducing a signal. The term PAR-2 refers to the protease-activated receptor-2 or a related protease activated receptor.
  • The Protease-activated receptor-2 (hereinafter, “PAR-2”) is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes and fibroblasts. The thrombin receptor (also named PAR-1, hereinafter, “TR”) is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes. The biological roles of PAR-2 and TR in skin are not entirely known. However, we have found that interactions between keratinocytes and melanocytes, via the PAR-2 pathway, affect melanogenesis. We have found that thrombin inhibitors, and/or tryptase inhibitors, and/or trypsin inhibitors and PAR antagonists can be used as depigmenting agents without irritation of the skin. PAR-2 agonists and serine proteases such as trypsin and tryptase can be used as darkening agents. Furthermore, PAR-2 could be useful as a target for whitening and darkening agents.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1A is a graph depicting the increase or decrease in relative pigmentation of epidermal equivalents containing melanocytes treated with known pigmenting and depigmenting agents in accordance with the methods of this invention.
  • FIG. 1B is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention.
  • FIG. 2 is a group of images of epidermal equivalents containing melanocytes treated with PAR-2 agonists and Compound I.
  • FIG. 3 is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention.
  • FIG. 4A is a graph depicting the dose/response with respect to pigmentation in epidermal equivalents containing melanocytes when treated with compositions of this invention.
  • FIG. 4B is a graph depicting the response of epidermal equivalents containing melanocytes after exposure to ultraviolet light followed by treatment with compositions of this invention.
  • FIG. 5A is a photograph depicting gels showing the expression of TR and PAR-2 in skin, melanoma cells and epidermal equivalents containing melanocytes.
  • FIG. 5B is a photograph depicting gels showing the expression of TR and PAR-2 by primary human melanocytes.
  • FIGS. 6A and 6B are photographs depicting gels showing the expression of various genes after treatment with different concentrations of Compound I and SLIGRL.
  • FIG. 7 is a graph showing the effects of different compositions of this invention on the brightness of guinea pig nipple pigmentation.
  • FIG. 8 is a photograph of Yucatan Swine skin which has been treated with compositions of this invention for depigmentation of skin.
  • FIG. 9 is a graph depicting the brightness of Yucatan Swine skin during the course of treatment in accordance with the methods and compositions of this invention.
  • FIGS. 10A, 10B, 10C and 10D are photographs of F&M stained histological sections of Yucatan Swine skin treated with compositions containing Compound I in accordance with methods of this invention at concentrations of 0, 10 μM, 50 μM and 250 μM respectively.
  • FIGS. 11A, 11B and 11C are photographs of electron micrographic views of epidermal equivalents containing melanocytes treated with compositions of this invention.
  • FIGS. 11E, 11F and 11H are photographs of electron micrographic views of Yucatan Swine skin treated with compositions of this invention.
  • FIGS. 11D and 11G are photographs of electron micrographic views of untreated sites of Yucatan Swine skin.
  • FIGS. 12A, 12B, 12C, 12D and 12E are photographs of histological F&M stained sections of Yucatan Swine skin, as follows: 12A shows untreated skin; 12B shows skin treated with compositions of this invention after eight weeks of treatment; 12C shows skin one week after stopping treatment; 12D shows skin two weeks after stopping treatment and 12E shows skin four weeks after stopping treatment.
  • FIG. 13 is a photograph of F&M stained histological sections taken from Yucatan Swine skin treated with compositions of this invention.
  • FIG. 14 contains ultraviolet and visible light digital photographs of human skin prior to treatment and subsequent to treatment with compositions of this invention.
  • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • We have discovered that trypsin, tryptase and PAR-2 agonists can be used to increase pigmentation and that trypsin inhibitors, and/or tryptase inhibitors, and/or thrombin inhibitors and PAR-2 antagonists act to decrease pigmentation in mammalian skin. In our opinion, some of the compounds described in U.S. Pat. No. 5,523,308, which is hereby incorporated herein by reference, and behave as thrombin and/or trypsin and/or tryptase inhibitors, will be useful in methods of this invention. Some of these compounds are also described in Costanzo, et al., “Potent Thrombin Inhibitors That Probe the S1′ Subsite: Tripeptide Transition State Analogues Based on a Heterocycle-Activated Carbonyl Group”, J. Med. Chem., 1996, Vol. 39, pp. 3039-3043 and have the following structural formula:
  • Figure US20080249029A1-20081009-C00001
  • wherein:
  • A is selected from the group consisting of C1-8alkyl, carboxyC1-4alkyl,
  • C1-4alkoxycarbonylC1-4alkyl, phenylC1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents are independently selected from one or more of, C1-4 alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), formyl, C1-4alkoxycarbonyl,
    C1-2alkylcarbonyl, phenylC1-4alkoxycarbonyl, C3-7cycloakylcarbonyl, phenylcarbonyl, substituted phenylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), C1-4alkylsulfonyl, C1-4alkoxysulfonyl, perfluoroC1-4alkyl-sulfonyl, phenylsulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), 10-camphorsulfonyl, phenylC1-4alkysulfonyl, substituted phenylC1-4alkysulfonyl, C1-4alkylsulfinyl, perfluoroC1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), phenylC1-4alkylsulfinyl, substituted pehnylC1-4alkylsulfinyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl or substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, carboxy or C1-4alkoxyy-carbonyl), 1-naphthylsulfinyl, 2-naphthylsulfinyl or substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl); a D or L amino acid which is coupled as its carboxy terminus to the nitrogen depicted in formula I and is selected from the group consisting of alanine, asparagine, 2-azetidinecarboxylic acid, glycine, N—C1-8alkyglycine, proline, 1-amino-1-cycloC3-8alkylcarboxylic acid, thiazzolidine-4-carboxylic acid, 5,5-dimethylthiazolidine-4-carboxylic acid, oxadolidine-4-carboxylic acid, pipecolinic acid, valine, methionine, cysteine, serine, threonine, norleucine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalamine, 2-thienylalanine, 3-thienylalanine, [1,2,3,4]-tetrahydroisoquinoline-1-carboxylic acid and 1,2,3,4,]-tetrahydroisoquinoline-2-caroboxylic acid
  • where the amino terminus of said amino acid is connected to a member selected form the group consisting of C1-4alkyl, tetrazol-5-yl-C1-2alkyl, carboxytC1-4alkyl, C1-4alkoxycarbonylC1-4alkyl, phenylC1-4alkyl, substituted phenyl C1-4 alkyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboy or C1-4alkoxycarbonyl), 1,1-diphenylC1-4alkyl, 3-phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyethylcarbonyl, [1,2,3,4]-tetrahydroisoquinoline-1-carbonyl, [1,2,3,4]-tetrahydroisoquinoline-3, carbonyl, 1-methylamino-1-cyclohexanecarbonyl, 1-hydroxy-1-cyclohexanecarbonyl, 1-hydroxy-1-pheny-lacetyl, 1-cyclohexyl-1-hydroxyacetyl, 3-phenyl-2-hydroxypropionyl, 3,3-diphenyl-2-hydroxypropionyl, 3-cyclohexyl-2-hydroxypropionyl, formyl, C1-4alkoxycarbonyl, C1-12alkylcarbonyl, perfluoroC1-4alkyl, C1-4alkylcarbonyl, phenylC1-4alkylcarbonl, substituted phenylC1-4alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl) 1,1-diphenylC1-4alkylcarbonyl, substituted 1,1-diphenylC1-4alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxy-carbonyl), perfluoroC1-4alkysulfonyl, C1-4alkysulfonyl, C1-4alkoxysulfonyl, phenysulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C-1alkyl, perfluoro C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 10-cxamphorsulfonyl, phenylC1-4alkylsulfonyl, substituted phenylC1-4alkylsulfonyl, perfluoroC1-4alkysulfinyl, C-14alkysulfinyl, phenylsulfinyl, substituted phenysulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4 alkylamino, C1-4 dialkylamino, carboxy or C1-4 alkoxycarbonyl), 1-naphthysulfonl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboy or C1-4alkoxycarbonyl), 1-naphthysulfinyl, 2-naphthysulfinyl, and substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C104dialkylamono, carboxy or C-14alkoxycarbonyl): or a poly peptide comprised of two amino acids,
  • where the first amino acid is a D or L amino acid, bound via its carboxy terminus tot he nitrogen depicted in Formula I and is selected from the group consisting of glycine, N—C1-8alkylglycine, alanine, 2-azetidinecarboxylic acid, proline, thiazolidine-4-carboxylic acid, 5.5-dimethylthiazolidine-4-carboxylic acid, oxazolidine-4-carboxylic acid, 1-amino-1-cycloC3-8 alkylcarboxylic acid, 3-hydroxypropoline, 4-hydroxyproline, 3-(C1-4alkoxy)proline, 4(C1-4alkoxy)proline, 3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid, 2.2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid, valine, methionine, cysteine, asparagine, serine, threonine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalanine, 2-thienylalanine, 3-thienylalnine, [1,2,3,4]-tetrahydroisoquinoline-2-carboxylic acid, aspartic acid-4-C1-4alkyl ester and glutamic acid 5-C1-4alkyl ester and the second D or L amino acid, is bound to the amino terminus of said first amino acid, and is selected from the group consisting of phenylalanine, 4-benzolyphenylalanine, 4-carboxyphenylalanine, 4-(Carboxy C1-2alkyl)phenylalanine, substituted phenylalanine (where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 3-benzothienylalanine, 4-biphenylalanine, homophenylalanine, octahydroindole-2-carboxylic acid, 2-pyridylalanine, 3-pyridylalanine, 4-thiazolyalanine, 2-thienylalanie, 3-(3-benzothienyl)alanine, 3-thienylalanine, tryptophan, tyrosine, asparagine, 3-tri-C1-4alkylsilylalanine, cyclohexylglycine, diphenylglycine, phenylglycine, methionine sulfoxide, methionine sulfone, 2,2-dicyclohexylalanine, 2-(1-naphthylalanine), 2-(2-naphthylalanine), phenyl substituted phenylalanine (where the substituents are selected from C1-4alkyl, perfluoroC1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialylamino, carboxy or C1-4 alkoxycarbonyl), aspartic acid, aspartic acid-4C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbony), aspartic acid, aspartic acid-4-C1-4alkyl ester glutamic acid, glutamic acid-5-C1-4 alkyl ester, cycloC3-salkylaalanine, substituted cycloC3-8alkylalanine (where the ring substituents are carboxy, C1-4 alkyl ester, cycloC3-salkylalanine, substituted cycloC3-aalkylalanine (where the ring substituents are carboxy, C1-4alkylcarboxy, C1-4alkoxycarbonyl or aminocarbonyl), 2,2-diphenylalanine and all alpha-C1-alkyl of all amino acid derivatives thereof, where the amino terminus of said second amino acid is unsubstituted or monosubstituted with a member of the group consisting of formyl, C1-12 alkyl, tetrazol-5-ylC1-2alkyl, carboxyC1-8 alkyl, carboalkoxyC1-4alkyl, phenyl C1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents or independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1-dipehnylC1-4alkyl, C1-6alkoxycarbonyl, phenylC1-6alkoxycarbonyl, C1-2alkylcarbonyl, perfluoroC1-4alkylC1-4alkylcarbonyl, phenyC1-4alkylcarbonyl, substituted phenyC1-4alkylcarbonyl(where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoro C1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1-diphenylC1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxycarbonyl), 10-camphorsulfonyl, phenylC1-4alkysulfonyl, substituted phenylC1-4alkylsulfonyl, C1-4alkysulfinyl, perfluoro C1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamono, C1-4dialkylamono, carboxy or C1-4alkoxycarbonyl), phenyC1-4alkylsulfinyl, substituted phenylC1-4alkylsulfinyl 1-naphthylsulfonyl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituent is selected from C1-4alkyl; pertluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1-haphthyl-sulfinyl, 2-haphthylsulfinyl and substituted naphthyl-sulfinyl (where the naphthyl substituent is selected from C1-4alkyl, perfluoroC1-4alkyl, C1-14alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C-14dialkylamino, carboxy or C1-4alkoxycarbonyl); R1 is selected from the group consisting of hydrogen and alkyl; R2 is selected from the group consisting of aminoC2-salkyl, guanidinoC2-5alkyl, C1-4alkylguanidinoC2-5alkyl, diC1-4alkylguanidinoC2-5alkyl, amidinoC2-5alkyl, C1-4alky-lamidinoC2-5alkyl, diC1-4alky-1amidinoC2-5alkyl, C1-3 alkoxyC2-5alkyl, phenyl, substituted phenyl (where the substituents are independently selected from one or more of amino, amidino, guanidino, C1-4alkylamino, C1-4dialkylamino, halogen, perfluoro C1-4alkyl, C1-4alkyl, C1-3 alkoxy or nitro), benzyl, phenyl substituted benzyl (where the substituents are independently selected from one or more of, amino, amidino, guanidino, C1-4alkylamino, C1-4dialky-lamino, halogen, perfluoro C1-4alkyl, C1-04alkyl, C1-3alkoxy or nitro); hydroxyC2-5alkl, C′1-5alkylaminoC2-5alkyl, C1-5dialkylaminoC2-5alkyl, 4-aminocyclohexylC0-2alkyl and C1-5alkyl;
  • p is 0 or 1;
  • B is
  • Figure US20080249029A1-20081009-C00002
  • where n is 0-3, R3 is H or C1-5alkyl and the carbonyl moiety of B is bound to E;
  • E is a heterocycle selected from the group consisting of oxazolin-2-yl, oxazol-2-yl, thiazol-2-yl, thiazol-5-yl, thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl, 4-oxo-2-quinoxalin-2yl, 2-pyridyl, 3-pyridyl, benzo[b]thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl, 4,5,6,7-tetrahydrobenzothiazol-2-yl, naphtho[2,1-d]thiazol-2-yl, naphtho[1-2-d]thiazol-2-yl quinoxalin-2-yl, isoquinolin-1-yl, isoquinolin-3-yl, benzo[b]furan-2-yl, [pyrazin-2-yl, quinazolin-2 yl, isothiazol-5-yl, isothiazol-3-yl, purin-8yul and a substituted heterocycle where the substituents are selected from C14 from C-14alky, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy, C1-4alkoxycarbonyl, hydroxy or phenylC1-4 alkylaminocarbonyl;
  • or pharmaceutically acceptable salts thereof.
  • More particularly, in our opinion, some of the compounds of the foregoing formula containing a d-phenylalanine-proline-arginine motif should be effective in inhibiting the PAR-2 pathway and causing depigmentation. One particularly preferred compound which acts as a thrombin and trypsin inhibitor and is active in depigmenting mammalian skin is (S)—N-Methyl-D-phenylalanyl-N-[4-[(aminoiminomethyl)amino]-1-(2-benzothiazolylcarbonyl)butyl]-L-prolinamide (Chemical Abstracts name) (hereinafter referred to as “Compound I”). We suggest that other compounds which are analogs or function similarly to Compound I and are set forth in U.S. Pat. No. 5,523,308 may be active in the methods and compositions of this invention. Other compounds that inhibit trypsin, such as serine protease inhibitors, and in particular, soybean trypsin inhibitor (STI) will also be useful in methods of this invention. Soybean, limabean and blackbean extracts, and other natural products made from these beans, such as, but not limited to, bean milk, bean paste, miso and the like, also serve to reduce pigmentation by this mechanism.
  • Additional sources of serine protease inhibitors may be extracted from the species belonging to the following plant families: Solanaceae (e.g., potato, tomato, tomatlla, and the like); Gramineae (e.g., rice, buckwheat, sorghum, wheat, barley, oats and the like); Cucurbitaceae (e.g., cucumbers, squash, gourd, luffa and the like); and, preferably, Leguminosae (e.g., beans, peas, lentils, peanuts, and the like).
  • While not willing to be bound by the following theory, we theorize that the compounds capable of affecting the pigmentation of the skin do so by interacting directly or indirectly with the keratinocyte PAR-2 or with its activating protease, and thereby affect melanogenesis, directly or indirectly. Possibly, the compounds of this invention induce, in the case of increased pigmentation or reduce, in the case of decreased pigmentation, the signal to transport melanosomes by melanocytes, or to receive melanosomes by keratinocytes in the skin.
  • The compounds which are active in the compositions and methods of this invention may be delivered topically by any means known to those of skill in the art. If the delivery parameters of the topically active pharmaceutical or cosmetic agent so require, the topically active composition of this invention may preferably be further composed of a pharmaceutically or cosmetically acceptable vehicle capable of functioning as a delivery system to enable the penetration of the topically active agent into the skin.
  • One acceptable vehicle for topical delivery of some of the compositions of this invention, particularly proteins such as trypsin and STI, may contain liposomes. The liposomes are more preferably none ionic and contain a) glycerol dilaurate (preferably in an amount of between about 5% and about 70% by weight); b) compounds having the steroid backbone found in cholesterol (preferably in an amount of between about 5% and about 45% by weight); and c) one or more fatty acid ethers having from about 12 to about 18 carbon atoms (preferably in an amount of between about 5% and about 70% by weight collectively), wherein the constituent compounds of the liposomes are preferably in a ratio of about 37.5:12.5:33.3:16.7. Liposomes comprised of glycerol dilaurate/cholesterol/polyoxyethylene-10-stearyl ether/polyoxyethylene-9-lauryl ether (GDL liposomes) are most preferred. Preferably the liposomes are present in an amount, based upon the total volume of the composition, of from about 10 mg/mL to about 100 mg/mL, and more preferably from about 20 mg/mL to about 50 mg/mL. A ratio of about 37.5:12.5:33.3:16.7 is most preferred. Suitable liposomes may preferably be prepared in accordance with the protocol set forth in Example 1, though other methods commonly used in the art are also acceptable. The above described composition may be prepared by combining the desired components in a suitable container and mixing them under ambient conditions in any conventional high shear mixing means well known in the art for non-ionic liposomes preparations, such as those disclosed in Niemiec et al., “Influence of Nonionic Liposomal composition On Topical Delivery of Peptide Drugs Into Pilosebacious units: An In Vivo Study Using the Hamster Ear Model,” 12 Pharm. Res. 1184-88 (1995) (“Niemiec”), which is incorporated by reference herein in its entirety. We have found that the presence of these liposomes in the compositions of this invention may enhance the depigmenting capabilities of some of the compositions of this invention.
  • Other preferable formulations may contain, for example, soybean milk or other liquid formulations derived directly from legumes or other suitable plant. For example, such a formulation may contain a large proportion of soybean milk, an emulsifier that maintains the physical stability of the soybean milk, and, optionally a chelating agent, preservatives, emollients, humectants and/or thickeners or gelling agents.
  • Oil-in-water emulsions, water-in-oil emulsions, solvent-based formulations and aqueous gels known to those of skill in the art may also be utilized as vehicles for the delivery of the compositions of this invention.
  • The source of active compound to be formulated will generally depend upon the particular form of the compound. Small organic molecules and peptidyl fragments can be chemically synthesized and provided in a pure form suitable for pharmaceutical/cosmetic usage. Products of natural extracts can be purified according to techniques known in the art. Recombinant sources of compounds are also available to those of ordinary skill in the art.
  • In alternative embodiments, the topically active pharmaceutical or cosmetic composition may be optionally combined with other ingredients such as moisturizers, cosmetic adjuvants, anti-oxidants, bleaching agents, tyrosinase inhibitors and other known depigmentation agents, surfactants, foaming agents, conditioners, humectants, fragrances, viscosifiers, buffering agents, preservatives, sunscreens and the like. The compositions of this invention may also contain active amounts of retinoids (i.e., compounds that bind to any members of the family of retinoid receptors), including, for example, tretinoin, retinol, esters of tretinoin and/or retinol and the like.
  • The topically active pharmaceutical or cosmetic composition should be applied in an amount effective to affect changes in the pigmentation of mammalian skin. As used herein “amount effective” shall mean an amount sufficient to cover the region of skin surface where a change in pigmentation is desired. Preferably, the composition is liberally applied to the skin surface such that, based upon a square cm of skin surface, from about 2 μl/cm2 to about 200 μl/cm2 of topically active agent is present when a change in pigmentation is desired. When using a thrombin and trypsin inhibitor such as compound I or its analogs, whether synthetically- or naturally-derived in a formulation, such an active compound should be present in the amount of from about 0.0001% to about 15% by weight/volume of the composition. More preferably, it should be present in an amount from about 0.0005% to about 5% of the composition; most preferably, it should be present in an amount of from about 0.001 to about 1% of the composition. Of course, these ranges are suggested for the foregoing components. The lower set of ranges is intended to be efficacious for PAR-2 pathway agonists/antagonists and/or inhibitors having high therapeutic indices and which do not require significantly larger concentrations or doses to be effective in the methods of this invention. Such compounds may be synthetically- or naturally-derived.
  • Liquid derivatives and natural extracts made directly from plants or botanical sources may be employed in the compositions of this invention in a concentration (w/v) from about 1 to about 99%. Fractions of natural extracts and naturally-derived protease inhibitors such as STI may have a different preferred range, from about 0.01% to about 20% and, more preferably, from about 1% to about 10% of the composition. Of course, mixtures of the active agents of this invention may be combined and used together in the same formulation, or in serial applications of different formulations.
  • We have unexpectedly found that when topically active agents, such as PAR-2 agonists and/or inhibitors and tryosin and/or thrombin and/or tryptase and/or their inhibitors, are topically applied to an animal's skin, a significant change in pigmentation was achieved. Preferably, depigmenting agents (as well as other pigmentation-affecting agents of this invention) are applied to the skin of a mammal at a relatively high concentration and dose (from about 0.005% to about 1% for compounds having high therapeutic indices such as Compound I and related compounds; from about 20% to about 99% for liquid derivatives and extracts of botanical materials; and from about 1% to about 20% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof) between one and two times daily for a period of time until the skin evidences a change in pigmentation. This may be for from about four to about ten weeks or more. Thereafter, once the change in pigmentation has been achieved, a lower concentration and dose (from about 0.00001% to about 0.005% for compounds having high therapeutic indices such as Compound I and related compounds; from about 10% to about 90% for liquid derivatives and extracts of botanical materials; and from about 0.01% to about 5% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof), of active ingredient may be applied on a less frequent time schedule, e.g., about once per day to about twice per week. The effects of the active agents of this invention are reversible, therefore, in order to maintain these effects, continuous application or administration should be performed. The invention illustratively disclosed herein suitably may be practiced in the absence of any component, ingredient, or step which is not specifically disclosed herein.
  • Several examples are set forth below to further illustrate the nature of the invention and the manner of carrying it out, but do not serve to limit the scope of the methods and compositions of this invention.
  • Example 1 Protease Inhibitors Affect Pigmentation
  • In order to study the possible roles of the PAR-2 pathway in pigmentation, an in vitro epidermal equivalent system was used. The epidermal equivalent system used contained melanocytes. One epidermal equivalent system which is useful in performing this study is the MelanoDerm system, available commercially from MatTek Co. This system contains human normal melanocytes, together with normal, human-derived epidermal keratinocytes, which have been cultured to form a multi layered, highly differentiated model of the human epidermis. In the following examples, equivalents were treated with test compounds for three days and samples were harvested on the fourth day after beginning of treatment. The harvested equivalents were stained with DOPA (a substrate for tyrosinase) and H&E (a standard histological stain) or with Fontana-Mason (F&M) staining, another stain known to those of skill in the art. F&M staining is a silver staining technique that clearly and cleanly marks melanins which have high silver nitrate reducing activity.
  • Multilayered human epidermal equivalents containing melanocytes were used as an in vitro model system to study the effect of protease inhibitors on melanogenesis. Epidermal equivalents used were commercially available as MelanoDerm from MatTek of Ashland, Mass. These equivalents are known to respond to ultraviolet B (“UVB”) irradiation and known whitening agents such as benzaldehyde and hydroquinone by increasing and reducing pigmentation, respectively. The MelanoDerm epidermal equivalents were exposed to benzaldehyde (available from Sigma of St. Louis, Mo.), hydroquinone (available from Sigma) and UVB irradiation. UV irradiation was performed with a UVB FS light source in an exposure chamber, with plate covers removed and Phosphate-buffered saline (PBS, from Gibco-BRL, Gaithersburg, Md.) present in the lower chamber. UVB intensity was measured with a UVX radiometer (UVP Inc., San Gabriel, Calif.). Equivalents were treated with 0.1-0.12 J/cm2 No loss of viability was observed in equivalents treated with up to 0.3 J/cm2.
  • On the fourth day of exposure to the test compounds/ultraviolet irradiation, the equivalents were fixed, sectioned and stained, or stained as whole without sectioning. MelanoDerm equivalents were formalin fixed and put in paraffin blocks, and sections from the MelanoDerm equivalents were stained in accordance with the following standard procedures: (1) H&E, (2) DOPA+H&E and (3) Fontana-Mason (“F&M”) using standard techniques known to those of skill in the art. Alternatively, whole MelanoDerm equivalents were stained and their images were captured for image analysis. At least three sections per equivalent, three equivalents per experiment were processed. Each experiment was repeated three time. DOPA is a substrate for tyrosinase.
  • F&M identifies silver nitrate reducing molecules, which identifies primarily melanins. F&M stained sections were used for image analysis using Optomax Image Analysis Systems, from Optomax Inc., Hollis, N.H. Alternatively, Empire Images database 1.1 was used on a Gateway 2000 PS-100 computer (Media Cybernetics, Silver Springs, Md.) for capturing images. Image Pro Plus version 4.0 was used for image analysis. Parameters measured were as follows: (1) level of pigmentation within individual melanocytes and (2) number of pigmented melanocytes per field, for the Optomax system, or (1) the surface area of silver deposits within melanocytes and (2) the number of pigmented melanocytes for the Image Pro system. Using the Optomax system, surface area of silver deposits within individual melanocytes was measured in 60 melanocytes, using multiple sections from triplicate equivalents per treatment. The number of melanocytes per field was calculated in these sections. A “pigmentation factor” was defined as the average surface area of silver deposits within an individual melanocyte, multiplied by the number of pigmented melanocytes per field. A value of one was assigned to untreated controls, and values of treatment groups were normalized to their relevant controls. Using the Image Pro system, surface area of silver nitrate deposits and number of melanocytes were measured for whole equivalents. A value of one was assigned to untreated controls and values of treatment groups were normalized to their relevant controls.
  • FIG. 1A is a graph depicting the increase or decrease in relative pigmentation, as measured and calculated by the whole equivalent/Image Pro system, as set forth above, when exposed to benzaldehyde (500M), hydroquinone (50 M) and UVB irradiation (0.12 J/cm2).
  • The human epidermal equivalents were also exposed to mixtures of protease inhibitors, said protease inhibitors are set forth in Table A below. The protease inhibitors were available from Boehringer Mansheim of Indianapolis, Ind. Complete® Protease Inhibitor Cocktail tablets available from Boehringer Mannheim were used, containing inhibitors of chymotrypsin, thermolysin, papain, pronase, pancreatic extract and trypsin. Soybean trypsin inhibitor (“STI”) was available from Sigma and was dissolved in a 50 mg/ml liposome vehicle or in 1×PBS. All other protease inhibitors used in this in vitro example were dissolved in 1×PBS. GDL liposomes were prepared as set forth in Niemic, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van Dyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes. These mixtures of protease inhibitors and different combinations of serine protease inhibitors were tested for their ability to affect melanogenesis. As set forth in FIG. 1B, some of the serine protease inhibitors, particularly STI (soybean trypsin inhibitor), were very effective in inhibiting melanogenesis.
  • TABLE A
    Test Formulation Ingredients
    Complete ® Total protease inhibitor mixture - x
    Mix-1 Serine Protease inhibitors - 90 μg/m
    Phenylmethyl-sulfonyl fluoride (“PMS
    and
    50 μg/mL L-1-Chloro-3-[4-tosylamido]
    phenyl-2-butanone (“TPCK”)
    Mix-2 Serine protease inhibitors - 0.1 μg/
    aprotinin,
    50 μg/mL Soybean trypsin inhibitor
    (“STI”), 0.5 μg/mL leupeptin and 0.2
    μg/mL
    (L-1-Chloro-3-[4-tosylamido]-7-amino
    heptanone-HCl) (“TLCK“)
    STI Soybean trypsin inhibitor - 1 mg/ml
  • Example 2 A Protease-Activated Receptor is Involved in Pigmentation
  • Example 1 demonstrates that STI reduces pigmentation. STI inhibits trypsin. Because trypsin is known to activate TR and PAR-2, we tested the possible involvement of TR and PAR-2 in pigmentation. MelanoDerm human epidermal equivalents were treated with the TR and PAR-2 agonists and antagonists set forth in Table B below daily for three days. On the fourth day, the samples were harvested, fixed, and DOPA, H&E or F&M staining was performed. Histological and whole-equivalent examination revealed changes in pigmentation following the treatments. FIG. 2 depicts the results of this example. As shown therein, the PAR-2 peptide agonist SLIGRL induced pigmentation in individual melanocytes. Treatment with Compound I, an inhibitor of thrombin and trypsin, resulted in decreased pigmentation.
  • FIG. 3 shows the results of the studies set forth in this example, representing the level of pigmentation in MelanoDerm equivalents treated with TR and PAR-2 reagents. SLIGRL, a PAR-2 agonist, dramatically increased pigmentation, indicating that PAR-2 might be involved in pigmentation. Hirudin, a thrombin-specific inhibitor, and TFLLRNPNDK, a TR selective agonist had no effect on pigmentation. However, SFLLRN, a less specific TR agonists, showed a trend of lightening or reducing pigmentation. This indicates that TR is less likely to be involved in pigmentation.
  • TABLE B
    TR and PAR-2 Reagents Description
    Thrombin Activates TR
    Trypsin Activates TR and PAR-2
    TFLLRNPHDK TR peptide agonist - activates TR only
    SLIGRL PAR-2 peptide agonist - activates PAR-2 o
    SFLLRN TR peptide agonist - activates TR,
    cross-reacts with PAR-2
    FSLLRN Scrambled peptide - inactive
    Hirudin Specific inhibitor of thrombin
    Compound I Thrombin and trypsin inhibitor
  • Example 3 A Dose-Response Relation Between Protease-Activated Receptors Signaling and Melanogenesis
  • MelanoDerm equivalents were treated with increasing concentrations of SLIGRL, the PAR-2 peptide agonist, at 0, 10 and 50 μM in the same manner as set forth in Example 2. F&M staining was performed in the fourth day. As shown in FIG. 4A, increasing concentrations of SLIGRL, the PAR-2 activator, result in increased pigmentation. Trypsin, a PAR-2 activator, has the same effect. Treatment with increasing concentrations of Compound I, the thrombin and trypsin inhibitor, from 0.1 pM to 1 μM resulted in decreasing pigmentation (see FIG. 4A). Pretreatment of the equivalents with UVB irradiation increased melanogenesis, relative to untreated controls. Compound I was able to reduce this UVE-induced pigmentation as well (FIG. 4B). This example demonstrates a dose-response relation for increasing and decreasing pigmentation with the modulation of PAR-2 signaling. This example also demonstrates that Compound I can inhibit pigmentation and prevent UV-induced pigmentation.
  • Example 4 PAR-2 is Expressed in Keratinocytes, but not in Melanocytes
  • PAR-2 and TR expression have been demonstrated previously in keratinocytes and fibroblasts. This example demonstrates that PAR-2 is expressed in keratinocytes, but not in melanocytes. Furthermore, it demonstrates that TR is expressed in both keratinocytes and melanocytes.
  • In order to demonstrate this, MelanoDerm human epidermal equivalents, human primary melanocyte cultures (neonatal and adult, from Clonetics of San Diego, Calif.) and Cloudman S91 mouse melanoma cells from ATCC of Rockville, Md. were grown in culture and total RNAS were extracted using “RNA Stat-60” reagent available from “Tel-Test B”, Incorporated as described in Chomczymski, “Single Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-phenol-chloroform extraction,” 162 Anal. Biochem. 156-69 (1987). A sufficient amount of RNase-free DNase available from Promega Corporation under the tradename “RQ1 RNase-free DNase” was then added to the extracted RNA from each sample such that each respective product will yield 200 ng of DNased-RNA using the procedure set forth in “RNase-free DNase”, protocol published by Promega Corporation (May, 1995). The resulting 200 ng of DNased-RNA was reverse transcribed (“RT”) via the procedure set forth in “Superscript II Reverse Transcriptase” a protocol published by Gibco-BRL (now Life Technologies, Incorporated) (April 1992), using random hexamers such as the random primers which are commercially available from Life Technologies, Incorporated.
  • The resulting RT products were then amplified via polymerase chain reaction (“PCR”) using about a 0.5 unit (per 100 μl reaction) of a thermostable DNA polymerase which is commercially available from Perkin-Elmer-Cetus Corporation under the tradename “Taq polymerase” and about 0.1 μmol/reaction of TR and PAR-2 specific primers as described in Table C and in Marthinuss et al., 1995 which is hereby incorporated herein by reference or of glyceraldehyde-3-phosphate-dehydrogenase (G3PDH) primers, available from Clontech Laboratories, Inc. of Palo Alto, Calif. in accordance with the procedures set forth in Marthinuss et al., 1995 or in the protocol accompanying the primers from Clontech Laboratories.
  • The PCR products were then analyzed using 2% agarose/ethidium bromide gels according to methods well-known in the art in order to compare the level of expression of certain genes in keratinocytes and melanocytes. When necessary for better visualization, the resulting PCR products were precipitated with ethanol according to well-known procedures. When primers for G3PDH were used, only 10% of the PCR reaction products were used. An RNA sample from epidermal equivalents that was not reverse-transcribed was used as a negative control for each PCR amplification. The lack of genomic DNA contaminants was indicated by the lack of a band on the relevant lanes in the gels. A human skin RNA sample which was reverse-transcribed was used as a positive control when commercial positive controls were not available. The migration of the RT-PCR products on the gels was always identical to that of the positive controls, and to that of the reported amplimer sizes.
  • The relative quality of each respective RT-PCR reaction product was then compared by analyzing the mRNA level of G3PDH, a “housekeeping” gene, in each respective product. As illustrated in FIGS. 5 and 6, G3PDH gene expression was found to be similar at all the time points examined, which thereby enabled the comparison of the relative levels of gene expression for the desired genes.
  • FIG. 5A shows that, as expected, TR and PAR-2 are expressed in total skin and in the MelanoDerm equivalents (“MD”). However, S91 melanoma cells (“S91”) did not express PAR-2 or TR. To investigate this further, we tested primary newborn (“mel-NB”) and adult (“mel-A”) melanocytes for TR and PAR-2 expression. As shown in FIG. 5B, primary human melanocytes express TR but not PAR-2. Therefore, we suggest that PAR-2 agonists and antagonists can interact with keratinocytes, but not with melanocytes, in the MelanoDerm equivalents, and that TR agonists and antagonists could interact with both keratinocytes and melanocytes. A keratinocyte-melanocyte interaction is, therefore, suggested, during which the keratinocyte-PAR-2 signal is converted into a pigmentation end point.
  • Table C illustrates some of the DNA primers used, the amount of MgCl2 required for the PCR reaction, and the length of the PCR cycle.
  • TABLE C
    DNA Primers Utilized in RT-PCR Assay
    Amt. DNA
    Primer of Cycle No. Seq.
    (See attached MgCl2 (min) @ of ID
    Sequence Listing) (mM) ° C. cycles No.
    Tyrosinase sense 1.25 1 @ 94 35 1
    TCAGCCCAGC ATCCTTCTTC 2 @ 55
    3 @ 72
    Tyrosinase antisense 1.25 1 @ 94 35 2
    CAGCCATTGT TCAAAAATAC 2 @ 55
    TGTCC 3 @ 72
    TRP-1 sense 2.5 1 @ 94 35 3
    5′CCACTCTAATAAGCCCAAAC 2 @ 55
    3 @ 72
    TRP-1 antisense 2.5 1 @ 94 35 4
    5′CTCAGCCATTCATCAAAGAC 2 @ 55
    3 @ 72
    TRP-2 sense 2.5 1 @ 94 35 5
    5′AAAAGACATACGAGATTGCC 2 @ 55
    3 @ 72
    TRP-2 antisense 2.5 1 @ 94 35 6
    5′CACAAAAAGACCAACCAAAG 2 @ 55
    3 @ 72
    Trypsin sense 2.5 1 @ 94 35 7
    5′ATCC/TACTCCTGATCCTTACC 2 @ 45
    3 @ 72
    Trypsin antisense 2.5 1 @ 94 35 8
    5′TGTCATTGTT/CCAGAGTCT/ 2 @ 45
    CT/GC/GC 3 @ 72
    PAR-2 sense - 2.5 .5 @ 94  30 9
    GGGAAAGGGGTTGGGGTAGA 1 @ 55
    CCAGGCTTTTCC (5′) 3 @ 72
    PAR-2 antisense - 2.5 .5 @ 94  30 10
    GGCCAACGGCGATGTTTGCCTT 1 @ 55
    CTTCCTGGGG (3′) 3 @ 72
    TR-sense - 2.5 .5 @ 94  30 11
    CCTCTGAGTGCCAGAGGTACG 1 @ 55
    TCTACAG (5′) 3 @ 72
    TR-antiseense - 2.5 .5 @ 94  30 12
    CCTAAGTTAACAGCTTTTTGTAT 1 @ 55
    ATGCTGTTATTCAGG (3′) 3 @ 72
    Thrombin-sense - 2.5 .5 @ 94  35 13
    AACCTGAAGGAGACGTGGAC 1 @ 55
    (3′) 3 @ 72
    Thrombin-antisense - 2.5 .5 @ 94  35 14
    CAGGAGCCCAGAATATGAGTG 1 @ 55
    (5′) 3 @ 72
  • Example 5 Keratinocyte-Relanocyte Contact is Required for Compound I Depigmenting Effect
  • The results of Example 4 suggest that melanocytes alone might not respond to the depigmenting effect of PAP-2 antagonists. Indeed, the level of pigmentation of human primary melanocytes or choleratoxin-induced S91 cells, which is reduced by hydroquinone and benzaldehyde, was not affected by Compound I.
  • Since PAR-2 is not expressed in melanocytes, we tested the possible requirement of keratinocyte-melanocyte interactions for the depigmenting effect of Compound I. Primary melanocyte cultures were compared to identical cultures plated under epidermal equivalents (EpiDerm, lacking melanocytes) to create a co-culture with no contact between keratinocytes and melanocytes. These were also compared to MelanoDerm equivalents, where melanocytes are present in the basal layer of the equivalent. Cultures were treated for three days with Compound I, with the PAR-2 agonist SLIGRL, and with the TR agonist TFLLRNPNDK, as set forth in Table D, and DOPA stained on the fourth day. In Table D, keratinocytes are indicated by “K”, melanocytes are indicated by “M” and lack of keratinocyte-melanocyte contact is indicated as “no K-M contact”. As shown in Table D, no effect on pigmentation was observed in primary melanocytes and in co-cultures treated with these agents. In MelanbDerm equivalents, compound I reduced and SLIGRL induced pigmentation, while TFLLRNPNDK had no effect. These results demonstrate that keratinocyte melanocyte contact is required for the PAR-2 effect on pigmentation.
  • TABLE D
    Melanocytes Co-cultures MelanoDerm
    Treatment (no K) (no K-M contact) (K-M contact)
    Compound I no effect no effect lightening
    SLIGRL no effect no effect darkening
    TFLLRNPNDK no effect no effect no effect
  • Example 6 Compound I Affects Melanocyte Gene Expression
  • MelanoDerm equivalents were treated with increasing concentrations of the thrombin and trypsin inhibitor, Compound I, or with increasing concentrations of the PAR-2 agonist SLIGRL. RNAs extracted from untreated and Compound I-treated equivalents were analyzed for gene expression by RT-PCR in the manner set forth above in Example 4. Gene-specific primers were designed as set forth in Table C above, and Clontech primers for human G3PDH were used as in Example 4. Melanogenic genes tested for expression level were tyrosinase, TRP-1, and TRP-2.
  • A dose-dependent decrease in TRP-1 and a dose-dependent increase in TRP-2 mENA levels were observed in Compound I-treated samples, as shown in FIG. 6A. Tyrosinase expression, however, was not affected. These changes correlated with the dose-dependent whitening effect of this inhibitor. Both patterns of gene expression result in a lightening effect. TRP-2 enzyme processes dopaquinone to 5,6-dihydroxyindole carboxylic acid (DHICA), rather than to 5,6-dihydroxyindole (DHI). This process results in brown, finely dispersed eumelanin, as opposed to insoluble black eumelanin, and results in a lighter skin tone. TRP-1 stabilizes the melanogenic complex, enabling pigment production. Reduced levels of TRP-1 result in reduced tyrosinase activity and reduced pigmentation. Lack of this protein results in albinism. Increasing concentrations of SLIGRL, however, did not affect melanogenic gene expression (FIG. 6B).
  • TRP-1 and TRP-2 are melanocyte-specific. Compound I inhibits trypsin and thrombin. Hirudin, a specific thrombin inhibitor, had no effect on pigmentation, as seen above in Example 2. Thus, we decided to test whether trypsin and thrombin are expressed in skin. A probe designed to detect both brain and gastric trypsins, as described in Table C, detected the expression of both mRNAs in a total skin mRNA sample available from Invitrogen of Carlsbad, Calif., as well as in MelanoDerm equivalents. The same expression pattern was detected for thrombin. Both trypsin and thrombin were not expressed in normal melanocytes (FIGS. 5A, B). These data suggest that if trypsin activates PAR-2, it could be produced by the keratinocytes only. As shown in FIG. 6A, treatment with Compound I resulted in increased expression of trypsin. SLIGRL, which did not affect melanogenesis gene expression (FIG. 6B) also increased trypsin expression in the equivalents. We conclude that while trypsin is a possible natural activator of PAR-2 in skin and possibly affects pigmentation, its mRNA levels do not correlate with pigmentation. This suggests that another, yet unidentified serine protease, which is inhibited by compound I, STI and the like, is the natural activator of PAR-2 in the epidermis. Compounds that induce or inhibit this protease would serve as darkening and lightening agents, respectively.
  • Example 7 Thrombin and Trypsin Inhibitors and PAR-2 Agonists Affect Pigmentation In Vivo
  • Two guinea pigs were treated twice daily, five days/week for seven weeks with Compound I at 1 and 10 μM in 70:30 ethanol:propylene glycol vehicle on one pigmented nipple. The other nipple of each animal was treated with vehicle only and served as a control. Chromameter measurement after seven weeks of treatment revealed a dose-dependent lightening effect of +9.6 L* and nearly 18 L* units respectively. No visible signs of irritation were observed at that time.
  • Four groups of three guinea pigs each were treated respectively with Compound I, SFLLRN, FSLLRN and SLIGRL at 10 μM, twice daily five days per week for eight weeks. Chromameter measurement after six weeks demonstrates a lightening effect by Compound I and a darkening effect by SLIGRL, the PAR-2 agonist. The results of this example are set forth in FIG. 7.
  • Example 8 Thrombin and Trypsin Inhibitors and PAR-2 Agonists Affect Pigmentation In Vivo
  • A Yucatan mitroswine was treated with Compound I, SFLLRN, FSLLRN and SLIGRL at 10 μM. Each compound was applied to two sites on the pig twice daily, five days per week for eight weeks. After eight weeks of treatment, chromameter measurements were taken. The application of Compound T resulted in a visible lightening effect. The PAR-2 agonist SLIGRL resulted in a darkening effect as measured by chromameter. SFLLRN and FSLLRN had no significant effects.
  • Two Yucatan swine were treated for seven and a half weeks, or for ten weeks, twice daily, five days per week, with increasing concentrations of Compound I. Four concentrations of active compound were used, as follows: 0, 10, 50 and 250 μM. Two sites per concentration were placed on opposite sides of the swine dorsum. Chromameter measurements were taken before treatment started and every two weeks thereafter. Pictures were taken periodically and at the end of the experiment. A visible lightening effect was observed during the 4th, 5th and 6th weeks of treatment, for the 250, 50 and 10 μM treatments, respectively. By the eighth week, the whitening effect of the two highest doses was similar. These results are illustrated in FIG. 8. The chromameter readings (L*, measuring brightness) during the treatment course of one swine are shown in FIG. 9. A saturation effect is observed, which is a time and concentration dependent. This example demonstrates a visual depigmenting effect by Compound I, in the animal model system most resemble pigmented human skin.
  • At the end of these experiments, biopsies were taken for histological and electron microscopy (EM) analyses. Histological samples were stained with HEE and F&M. H&E staining showed that there was no irritation, inflammatory response or changes in skin architecture, demonstrating the safety of using Compound I over long periods of time. F&M staining demonstrated that there was reduced pigmentation in the treated samples, both in the basal layer and throughout the epidermis. These results are illustrated in FIG. 10. Untreated and vehicle-treated samples (FIG. 10A) were identical and darkest. The 10 μM treatment (FIG. 10B) showed reduced pigmentation and the 50 and 250 μM treatments (FIGS. 10C, 10D, respectively) were the lightest.
  • The results of this example suggest that the maximal whitening effect of Compound I could be achieved with higher concentration over a shorter period of time or with lower concentration over a longer period of time. Thus, at least two difference regimens may be used to achieve the desired skin whitening results.
  • Example 9 Ultrastructural Studies Demonstrate the Effect of Compound I on the Skin In Vitro and In Vivo
  • Ultrastructural analysis was performed on MelanoDerm equivalents and swine skin sites treated with Compound I. MelanoDerm equivalents treated with Compound I were analyzed for melanosome formation and distribution using electron microscopy. Treated samples contained more melanosomes, but less mature melanosomes, i.e., melanosomes which evidence reduced melanin production, within the melanocytes, relative to untreated controls (FIGS. 11A, 11B). Dendrites containing melanosomes were easily identified within treated keratinocytes (FIG. 11C), but were difficult to find within control keratinocytes. This suggests abnormal melanosome formation and slow or impaired melanosome transfer into keratinocytes in the treated samples.
  • Skin samples from Yucatan swine treated with compound I for eight weeks, as described in example 8, were also analyzed by electron microscopy. Melanosomes within keratinocytes of treated sites were smaller and less pigmented, compared to controls (FIGS. 11D, 11E and 11F). Moreover, the distribution of melanosomes within the treated skins was abnormal. Melanosomes were detected mainly at the epidermal-dermal border, compared to a random distribution in untreated controls (FIGS. 11G, 11H). While we cannot rule out other mechanisms, we suggest that Compound I treated keratinocytes were unable to actively take or receive melanosomes from the presenting dendrites.
  • Example 10 The In Vivo Depigmenting Effect of Compound I is Reversible
  • A Yucatan swine was treated with Compound 1,250-M, for eight weeks, twice daily, five days a week, on eight sites. All sites showed visible depigmentation by the end of the treatment period, as set forth in FIG. 12B. For the following four weeks (starting at week nine of the experiment), the color of the treated sites was monitored, and two biopsies were taken each week from two treated sites. Untreated sites were biopsied as well. The depigmenting effect could be visualized at one and two weeks post treatment, and a complete reversal was observed by the forth week. Histological examination of F&M stained skin sections confirmed the repigmentation observed visually (as indicated in FIG. 12). As early as one week post treatment, repigmentation was demonstrated histologically. The visual observations correlate with the histological demonstration of stratum corneum pigmentation. This example demonstrates that Compound I does not induce a permanent damage to the pigmentation machinery, and its effect is reversible in vivao. FIG. 12A shows two histological F&M stained sections of sites which were not treated with Compound I. FIG. 12B shows two histological F&M stained sections of sites which were treated with Compound I for eight weeks. FIG. 12C shows sections of sites which were treated for eight weeks with Compound I, one week after treatment was stopped. FIG. 12D shows sections of sites which were treated for eight weeks with Compound I, two weeks after treatment was stopped. FIG. 123 shows sections of sites which were treated for eight weeks with Compound I, four weeks after treatment was stopped. As indicated in FIG. 12E, the sections were fully repigmented four weeks after the end of treatment.
  • Example 11 Preparation of Naturally-Derived Products Containing STI
  • Example 1 demonstrates that the presence of soybean trypsin inhibitor in any lightening formulation is desirable for its depigmenting activity. Based on analytical testing, it has been determined that soybean milk and soybean paste are rich sources of soybean trypsin inhibitor.
  • To make soybean paste, soybeans were first soaked in deionized or purified water for several hours. The soybeans were ground after they were fully hydrated, with the addition of small quantities of water, if needed, to smoothen the paste. To make soybean milk, the same procedure was performed with the addition of more water. (The grinding process allows the soybean milk to be extracted). After collection, the soybean milk was filtered to remove any residual parts of the bean husk.
  • Soybean milk, soybean paste and miso were prepared to be used as naturally-derived materials that contain STI and are able to lighten skin color.
  • Example 12 Treatment with Naturally-Derived Materials that affect the PAR-2 Pathway Induces Depigmentation
  • Two Yucatan swine were treated for eight and ten weeks, twice a day, five days a week, with different soybean- and lima-bean-derived products. These natural products include soybean paste, soybean protein acid hydrolysate, misc, native and boiled soybean milk, and a commercially available extract of soybean (Actiphyte® of Active Organics, Dallas Tex.), as well as purified STI, and different preparations of trypsin inhibitors from soybeans and limabeans. At seven weeks of treatment, all sites were visually lighter than the surrounding skin, except for the boiled soybean milk and the soybean protein acid hydrolysate treated sites. Histological analysis of biopsies from the treated sites following F&M staining confirmed the depigmenting effect of the soybean and limabean products. An example of such histological data is given in FIG. 13. The lack of depigmenting activity in the boiled soybean milk and in the soy protein acid hydrolysate is explained by the denaturation or the degradation of the soy proteins in these preparations, respectively. We theorize that the active depigmenting agents in the soybean and limabean products are soybean trypsin inhibitor (STI) and limabean trypsin inhibitor, respectively. (Example 1 shows the depigmenting effect of STI in vitro). This example demonstrate that natural extracts containing trypsin inhibitory activity could be used as whitening agents which affect the PAR-2 pathway.
  • Example 13 An STI in Liposome Formulation can Lighten Human Age Spots
  • An individual with three age spots on the dorsum of their hand was treated for eight weeks, twice a day, with the following: The age spot located closest to the arm was treated with placebo, containing 20 mg/ml of liposomes. The middle age spot was not treated. The third age spot was treated with STI, 1%, in liposomes (20 mg/ml). GDL liposomes were prepared as set forth in Niemiec, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van tyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes. UV and visible light digital pictures were taken at time 0, 4 and 8 weeks of treatment. L* (brightness) values were calculated from the images using Adobe Photoshop.
  • As shown in FIG. 14, the age spot treated with STI became lighter following 8 weeks of treatment. FIG. 14 is a composite of four pictures. The left panel is the visible light pictures of the hand, before (upper) and after (lower) 8 weeks of treatment. At this orientation the top age spot is the placebo-treated, the middle age spot is untreated, and the lower age spot is the STI-treated. The right panel shows the same hand at the same time points, using UV-photography. UV light enables the visualization of pigment deeper in the skin, demonstrating that the STI whitening effect was not superficial. FIG. 14 clearly demonstrates that the STI formulation was able to lighten the lower age-spot. An increase of 15 L* units was calculated for this STI-treated site, further demonstrating the ability of this treatment to lighten age spots.
  • Example 14 Depigmenting Formulations with Soybean Milk
  • In making the soybean milk, it was discovered that the rich emolliency of the milk would be desirable in a skin care formulation. Because water is used as the predominant ingredient of any oil-in-water emulsion, and in many other skin-care formulations we hypothesized that the soymilk could be used to substitute for the deionized water in such formulations. However, we expected that this type of formulation would not be physically stable due to the immiscibility of the oil and water components of the soybean milk. Surprisingly, we found that this substitution of soybean milk for water was physically stable. Formulations utilizing soybean milk should contain between about 1% and about 99% of soybean milk, more preferably from about 80% to about 95% soybean milk. Preferably, this and similar formulations should include a viscosity builder in an amount from about 0% to about 5% (more preferably, from about 0.1 to about 2%), one or more emollients in an amount up to about 20% and/or emulsifiers in an amount from about 0.1% to about 10% (more preferably from about 3 to about 5%), and, optionally, a spreading agent in an amount from about 0 to about 5% (more preferably from about 1 to about 2%), a preservative, a chelating agent or a humectant. The preservative should be present in an effective amount in order to preserve integrity of the milk and maintain the composition's activity. Sufficient thickener should be present to impart body to the formulation without causing it to become so viscous that it would hinder spreadability, e.g., from about 0 to about 10%, more preferably from about 3 to about 5%. Sunscreen, antioxidants, vitamins other depigmenting agents and other skin care topical ingredients may also be incorporated into the compositions of this invention.
  • A particularly preferred example of a depigmenting formulation substituting soymilk for water is shown in table E below.
  • TABLE E
    Ingredient Function % Wgt/Wgt
    soybean milk Vehicle, depigmenting 84.9%
    aluminum starch viscosity builder 0.75%
    octenyl succinate
    cyclomethicone spreading agent 2%
    PEG 6-capric/caprylic emollient/emulsifier 3%
    triglycerides
    phenoxyethanol preservative 0.75%
    sucrose cocoate emollient/emulsifier 1%
    Na2EDTA chelating agent 0.1%
    glycerin humectant 2.5%
    polyacrylamide; thickener 5%
    isoparaffin; laureth-7
  • STI, soybean paste and other trypsin inhibitor-containing natural extracts can be incorporated into such formulations to provide increasing concentrations of the serine protease inhibitor. Use levels of the added active ingredient can range between 0.01% to 15% in a formulation. Other depigmenting agents, including PAR-2 inhibitors, tyrosinase inhibitors, hydroquinones, soy products, ascorbic acid and its derivatives, as well as other ingredients with skin care benefits could also be incorporated into this formulation.
  • Example 15 An Oil-in-Water Emulsion Depigmenting Formulation
  • Two examples of a depigmenting formulation with oil-in-water emulsion are presented in Table F. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 4 of Table F. A similar formulation with Compound I is presented in column 5 of Table F. Compound I in this composition could be replaced with similar compounds, or with serine protease inhibitors or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table F. The deionized water content of these formulations could be replaced with soybean milk.
  • TABLE F
    Phase CTFA Name Function % W/W % W/W Ranges
    OIL Cetearyl Glucoside Surfactant 1.4 1.4 0.1-2.8
    C12-15 Alkyl Surfactant 4.0 4.0 1-6
    Benzoate
    Octyl Emollient 1.0 1.0 0-5
    Hydroxystearate
    Dimethicone Spreading 1.0 1.0 0-5
    Agent
    Cyclomethicone Spreading 1.0 1.0 0-5
    Agent
    Cetyl Alcohol Emollient 2.5 2.5 0-4
    Butylated Anti- 0.1 0.1   0-0.5
    Hydroxytoluene oxidant
    Octyl Sunscreen 6.0 6.0  0-10
    Methoxycinnamate
    Propylparaben Preservative 0.5 0.1   0-0.5
    Vitamin E acetate Anti- 0.5 0.5   0-0.5
    oxidant
    Tocopherol Acetate Anti- 0.5 0.5   0-0.5
    oxidant
    AQUEOUS Glycerine Humectant 3.0 3.0  0-20
    D-Pathenol Pro-Vitamin 0.5 0.5 0-5
    Disodium EDTA Chelator, 0.1 0.1 0.01-1  
    whitening
    agent
    Methyl Paraben Preservative 0.2 0.2   0-0.3
    Carbomer Thickener 0.35 0.35 0-3
    Deionized Water or Carrier/ 76.35 77.5 50-80
    Soybean Milk Whitening
    Agent
    STI or natural Whitening 1.0 0  0-15
    extract Agent
    Compound I Whitening 0 0.25 0-1
    Agent
  • To prepare this formulation, the ingredients of the lipid phase were combined and mixed at 85° C., and then cooled to 60° C. In a separate vessel, the carbopol was slowly added to the water or to the soybean milk. After mixing for ten minutes the rest of the aqueous phase ingredients were added and the mix was heated to 60° C. The two phases were then combined, mixed for ten minutes, and cooled to room temperature. Of course, one or more depigmentation agents may be combined within the same formulation, in this Example and in the following examples and other embodiments of the methods and compositions of this invention.
  • Example 16 Depigmenting Composition Oil-in-Water Emulsion
  • Two additional examples of an oil-in-water emulsion depigmenting formulation are presented in Table G. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 3 of Table G. A similar formulation with Compound I is presented in column 4 of Table G. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table G. The deionized water content of these formulations could be replaced with soybean milk.
  • TABLE G
    Pref'd.
    CTFA Name Function % W/W % W/W Ranges
    Ethanol Solvent 12.0 12.0  5-20
    Propylene Glycol Solvent 3.0 3.0  1-10
    Hydroxyethylcellulose Thickener/ 0.2 0.2 0-3
    Polymer
    Acrylates/C10-30 Thickener/ 1.0 1.0 0-3
    Alkyl Acrylate Polymer
    Crosspolymer
    Panthenol (98%) Pro-Vitamin/ 1.5 1.5 0.1-3  
    Humectant
    Fragrance Fragrance 0.5 0.5   0-0.5
    Isohexadecane Spreading 4.0 4.0 0-5
    Agent
    Vitamin E acetate Anti-oxidant 1.0 1.0 0-2
    Sodium Hydroxide Neutralizer 0.35 0.35 0.1-0.5
    Glycerine Humectant 3.0 3.0  0-20
    Deionized Water or Carrier/ 72.2 71.95 60-80
    Soybean Milk Whitening
    Agent
    Compound I Whitening 0 0.25 0-1
    Agent
    STI or natural extract Whitening/ 1.0 0  0-15
    Agent
  • To prepare this formulation, the hydroxyethylcellulose was slowly added to the water or to the soybean milk and stir until completely dissolved. In a separate container the Acrylates/C10-30 Alkyl Acrylate Crosspolymer was added and stir until completely dissolved. The content of the two containers was combined and mixed for 20 minutes Vitamin E acetate was then added and mixed, following by the addition of Isohexadecane and Panthenol (98%). After mixing for five minutes the STI, or the natural extract, or Compound I were added together with Propylene Glycol, and stirred for 5 minutes. Next, glycerine was added and the formulation was stirred for 20 minutes. Finally, the pH was adjusted with sodium hydroxide to 8 for STI (range is 6-8.5) or to 7 for Compound I (range is 5.5-8.5).
  • Example 17 Depigmenting Composition Water-In-Oil Emulsion
  • An example of a depigmenting formulation with water-in-oil emulsion is presented in Table H. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 4 of Table H. A similar formulation with Compound I is presented in column 5 of Table H. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table H. The deionized water content of these formulations could be replaced with soybean milk.
  • TABLE H
    Pref'd
    Phase CTFA Name Function % W/W % W/W Ranges
    OIL Mineral Oil Emollient 25.0 25.0 40-80
    Sorbitan Surfactant 5.0 5.0 1-6
    Monooleate
    Stearyl Alcohol Emollient 25.0 25.0 20-60
    Dimethicone Spreading Agent 1.0 1.0 1-5
    Cetyl Alcohol Emollient 2.0 2.0 0.1-10 
    Hydrogenated Anti-oxidant 3.0 3.0  0-10
    Lecithin
    Parsol MCX Sunscreen 3.0 3.0  0-10
    Propylparaben Preservative 0.5 0.5 0.01-0.5 
    Vitamin E Anti-oxidant 0.5 0.5 0.01-0.5 
    acetate
    AQUEOUS Glycerine Humectant 3.0 3.0  0-20
    Methyl Paraben Preservative 0.2 0.2 0.01-0.3 
    Water or Soy Carrier/ 30.8 31.55 20-45
    Milk Whitening Agent
    STI Whitening Agent 1.0 0  0-10
    Cpd I Whitening Agent 0 0.25 0-1
  • To prepare this formulation the stearyl alcohol and mineral oil were melted at 70° C. The other oil phase ingredients were added and the mixture heated to 75° C. The aqueous phase ingredients, which have been previously dissolved in the bulk phase water or Soy Milk and warmed to 70° C., were then added and the mixture was stirred until it congealed.
  • Example 18 Depigmentation Composition Aqueous Gel
  • Two examples of a depigmenting formulation with aqueous gel are presented in Table J. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 3 of Table J. A similar formulation with Compound I is presented in column 4 of Table J. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table J. The deionized water content of these formulations could be replaced with soybean milk.
  • TABLE J
    CTFA Name Function % W/W % W/W
    Octoxynol-13 Surfactant 0.2 0.2 0.05-0.5 
    2,4- Preservative 0.1 0.1   0-0.3
    Hexadienoic
    Acid
    Benzenemethanol Preservative 1.0 1.0 0-2
    Disodium EDTA Chelator/ 0.05 0.05 0.01-0.2 
    Preservative
    Ascorbic Acid Anti-oxidant 0.1 0.1   0-0.2
    Sodium Anti-oxidant 0.2 0.2   0-0.3
    Metabisulfite
    Carbomer Thickener 1.5 1.5   0-3.0
    NaOH %20 Soln. Neutralizer 2.45 2.45 0.1-5  
    DEIONIZED Carrier/ 93.4 94.15 85-98
    Water or Whitening Agent
    Soybean Milk
    STI or natural Whitening Agent 1.0 0  0-15
    extract
    Compound I Whitening Agent 0 0.25 0-1
  • To prepare this formulation, the Disodium EDTA, sodium metabisulfite and ascorbic acid were slowly added to the water or to the soybean milk and stir until completely dissolved. STI, natural extracts or Compound I were then added and mixed slowly for five minutes. The speed of agitation was then increased and carbopol was added. The composition was mixed for 30 minutes or until the dispersion was free of “fish eyes”, which are non-dispersed clear lumps, and heated to 50° C. In a separate container, the slurry phase was prepared by combining Octoxynol-13,2,4-Hexadienoic acid, and Benzenemethanol and stirring ten minutes at 40-50° C. The slurry was then added slowly to the aqueous phase, mixed, and cooled to 45° C. 20% sodium hydroxide solution was used to pH the composition to pH of 7.0 (range is 5.5-8.5). This was mixed to homogeneity using agitation or sweep vessel.
  • Example 19 Solvent-Based Depigmenting Composition
  • An example of a depigmenting formulation containing solvent is presented in Table K. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 3 of Table K. A similar formulation with Compound I is presented in column 4 of Table K. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table K. The deionized water content of these formulations could be replaced with soybean milk
  • TABLE K
    CTFA Name Function % W/W Range
    Ethanol Solvent (1) 70 40-90 
    Propylene Glycol Solvent (2) 29 1-40
    Deionized Water Carrier q.s. 1-40
    STI Whitening Agent 0
    Compound I Whitening Agent 1 μM .00001-1    

    To prepare this formulation Compound I was dissolved in water. The ethanol and propylene glycol were mixed and combined with the aqueous solution containing Compound I.
  • In summary, we have demonstrated that activation of the keratinocyte receptor PAR-2 results in increased pigmentation. Preferably, such activation may be accomplished by the use of trypsin or SLIGRL or SLIKOKVD or other SLTGRL or SLIGKVD derivatives. We have also demonstrated that whitening may be accomplished by the use of serine protease inhibitors or PAR-2 antagonists, as well as by melanosome-transfer blockers. Other compounds known to those of skill in the art that inhibit melanosome transfer into keratinocytes could also be used as depigmenting agents.
  • Compound I, a trypsin and thrombin inhibitor, for example, inhibits melanosome transfer to keratinocytes. STI works by the same mechanism, The accumulation of undelivered melanosomes in the melanocytes could induce a negative feed back mechanism, that slows new melanosome formation. The production of TRP-1, the major glycoprotein in melanocytes, is down-regulated, which leads to destabilization of tyrosinase. This results in reduced melanin formation, and in a color switch to a lighter brown, as the ratio of TRP-1:TRP-2 is reduced. The melanosomes accumulation in the melanocyte after Compound I treatment, or after STI treatment, therefore, have reduced and altered melanin content, which adds to the whitening effect of compound I or STI.

Claims (5)

1-9. (canceled)
10. A method of effecting changes in mammalian skin pigmentation comprising administering to a mammal a pigmentation-changing effective amount of a compound which affects the PAR-2-pathway wherein said compound is a compound of formula I:
Figure US20080249029A1-20081009-C00003
wherein:
A is selected from the group consisting of C1-alkyl, carboxyC1-4alkyl, C1-4alkoxycarbonylC1-4alkyl, phenylC1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents are independently selected from one or more of, C1-4 alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), formyl, C1-4alkoxycarbonyl, C1-2alkylcarbonyl, phenylC1-4alkoxycarbonyl, C3-7cycloakylcarbonyl, phenylcarbonyl, substituted phenylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), C1-4alkylsulfonyl, C1-4alkoxysulfonyl, perfluoroC1-4alkyl-sulfonyl, phenylsulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl, 10camphorsulfonyl, phenyl C1-4alkysulfonyl, substituted phenyl C1-4alkysulfonyl, C1-4alkylsulfinyl, perfluoroC1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), phenyl1C1-4alkylsulfinyl, substituted pheny1C1-4alkylsulfinyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl or substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of; C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, carboxy or C1-4alkoxy-carbonyl), 1-naphthylsulfinyl, 2-naphthylsulfinyl or substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl); a D or L amino acid which is coupled as its carboxy terminus to the nitrogen depicted in formula I and is selected from the group consisting of alanine, asparagine, 2-azetidinecarboxylic acid, glycine, N—C1-8alkyglycine, proline, 1-amino-1-cycloC1-8alkylcarboxylic acid, thiazzolidine-4-carboxylic acid, 5,5-dimethylthiazolidine-4-carboxylic acid, oxadolidine-4-carboxylic acid, pipecolinic acid, valine, methionine, cysteine, serine, threonine, norleucine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalamine, 2-thienylalanine, 3-thienylalanine, [1,2,3,4]-tetrahydroisoquinoline-1-carboxylic acid and 1,2,3,4,1-tetrahydroisoquinoline-2-caroboxylic acid
where the amino terminus of said amino acid is connected to a member selected form the group consisting of C1-4-alkyl,tetrazol-5yl-C1-2alkyl, carboxyC1-4alkyl, C1-4alkoxycarbony1C1-4alkyl, phenylC1-4alkyl, substituted phenyl C1-4 alkyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboy or C1-4alkoxycarbonyl), 1,1-diphenyl C1-4alkyl, 3phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyerthylcarbonyl, [1,2,3,4]-tetrahydroisoquinoline-1-carbonyl, [1,2,3,4]-tetrahydroisoquinoline-3,carbonyl, 1-methylamino-1-cyclohexanecarbonyl, 1-hydroxy-1-cyclohexanecarbonyl, 1-hydroxy-1-pheny-lacetyl, 1-cyclohexyl-1-hydroxyacetyl, 3-phenyl2-hydroxypropionyl, 3,3diphenyl-2-hydroxypropionyl, 3-cyclohexyl-2-hydroxypropionyl, formyl, C1-4alkoxycarbonyl, C1-12alkylcarbonyl, perfluoroC1-4alkyl, C1-4alkylcarbonyl, phenylC1-4alkylcarbonl, substituted phenylC1-4alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1diphenylC1-4alkylcarbonyl, substituted 1,1-diphenylC1-4-alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbanyl), perfluoroC1-4alkysulfonyl, C1-4alkysulfonyl, C1-4alkoxysulfonyl, phenysulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alklamino, C1-4dialkylamino, carboxy or C1-4alkoxcarbonyl), 10 camphorsulfonyl, phenylC1-4alkylsulfonyl, substituted phenyl C1-4alkylsulfonyl, perfluoroC1-4alkysulfinyl, C1-4alkysulfinyl, phenylsulfinyl, substituted phenysulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4 alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), 1-naphthysulfonl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-58-4alkoxycarbonyl),1-naphthysulfinyl, 2-naphthysulfinyl, and substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C1-4dialkylamono, carboxy or C1-4alkoxycarbonyl): or a poly peptide comprised of two amino acids,
where the first amino acid is a D or L amino acid, bound via its carboxy terminus to the nitrogen depicted in Formula I and is selected from the group consisting of glycine, N—C1-8alkylglycine, alanine, 2-azetidinecarboxylic acid, proline, thiazolidine-4-carboxyliic acid, 5,5 dimethylthiazolidine-4-carboxylic acid, oxazolidine-4-carboxylic acid, 1-amino-1-cycloC3-8alkylcarboxylic acid, 3-hydroxypropoline, 4-hydroxyproline, 3-(C1-4alkoxy)proline, 4(C1-4alkoxy) proline, 3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid, 2,2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid, valine, methionine, cysteine, asparagine, serine, threonine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalanine, 2-thienylalanine, 3thienylalnine, [1,2,3,4]-tetrahydroisoquinoline-2-carboxylic acid, aspartic acid-4-C1-4alkyl ester and glutamic acid 5-C1-4alkyl ester and the second D or L amino acid, is bound to the amino terminus of said first amino acid, and is selected from the group consisting of phenylalanine, 4-benzolyphenylalanine, 4-carboxyphenylalanine, 4-(Carboxy C1-2alkyl)phenylalanine, substituted phenylalanine (where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy C1-4dialkylamino, carboxy- or C1-4alkoxycarbonyl), 3-benzothienylalanine, 4biphenylalanine, homophenylalanine, octahydroindole-2-carboxylic acid, 2-Pyridylalanine, 3-pyridylalanine, 4-thiazolyalanine, 2-thienylalanine, 3-(3-benzothienyl) alanine, 3-thienylalanine, tryptophan, tyrosine, asparagine, 3-triC1-4alkylsilylalanine, cyclohexylglycine diphenylglycine, phenylglycine, methionine sulfoxide, methionine sulfone, 2,2-dicyclohexylalanine, 2-(1naphthylalanine), 2-(2-naphthylalanine), phenyl substituted phenylalanine (where the substituents are selected from C1-4(alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialylamino, carboxy or C1-4alkoxycarbonyl), aspartic acid, aspartic acid4C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbony), aspartic acid, aspartic acid-4-C1-4alkyl ester glutamic acid, glutamic acid-5-C1-4 alkyl ester, cycloC3-salkylaalanine, substituted cycloC3-8alkylalanine (where the ring substituents are carboxy, C1-4alkyl ester, cycloC3-8alkylalanine, substituted cycloC3-8alkylalanine (where the ring substituents are carboxy, C1-4alkylcarboxy, C1-4alkoxcarbonyl or aminocarbonyl), 2,2-diphenylalanine and all alpha-C1-5alkyl of all amino acid derivatives thereof, where the amino terminus of said second amino acid is unsubstituted or monosubstituted with a member of the group consisting of formyl, C1-12alkyl, tetrazol-5-y1C1-2alkyl, carboxyC1-8, alkyl, carboalkoxyC1-4alkyl, phenyl C1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents or independently selected from one or more of C1-4alkyl, perfluoroC1-4alkyl, C1-4-alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4, dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1-dipheny1C1-4alkyl, C1-6alkoxycarbonyl, phenylC1-6alkoxycarbonyl, C1-2alkylcarbonyl, perfluoroC1-4alkylC1-4alkylcarbonyl, phenyC1-4alkylcarbonyl, substituted phenyC1-4alkylcarbonyl(where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoro C1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl) 1,1-diphenylC1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxycarbonyl), 10-camphorsulfonyl, phenylC1-4alkysulfonyl, substituted phenyl C1-4alkylsulfonyl, C1-4alkysulfinyl, pertfluoro C1-4alkylsulfinyl phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamono, C1-4dialkylamono, carboxy or C1-4alkoxycarbonyl), phenyC1-4alkylsulfinyl, substituted phenylC1-4alkylsulfinyl l-naphthylsulfonyl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituent is selected from C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl;), 1-naphthyl-sulfinyl, 2naphthylsulfinyl and substituted naphthylsulfinyl (where the naphthyl substituent is selected from C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl); R1 is selected from the group consisting of hydrogen and alkyl; R2 is selected from the group consisting of aminoC2-5, alkyl, guanidinoC2-5alkyl, C1-4alkylguanidinoC2-5alkyl, diC1-4alkylguanidinoC2-5alkyl, amidinoC2-5alkyl, C1-4alky-lamidinoC2-5alkyl, diC1-4alky-lamidinoC2-5alkyl, C1-3alkoxyC2-5alkyl, phenyl, substituted phenyl (where the substituents are independently selected from one or more of amino, amidino, guanidino, C1-4alkylamino, C1-4dialkylamino, halogen, perfluoro C1-4alkyl, C1-3alkyl, C1-3alkoxy or nitro), benzyl, phenyl substituted benzyl (where the substituents are independently selected from one or more of, amino, amidino, guanidino, C1-4alkylamino, C1-4dialky-lamino, halogen, pertfluoro C1-4alkyl, C1-04alkyl, C1-3alkoxy or nitro), hydroxyC2-5alkyl, C1-5alkylaminoC2-5 alkyl, C2-5dialklaminoC2-5alkyl, 4-aminiocyclohexylCO-2alkyl and C1-5alkyl;
p is 0 or 1:
B is
Figure US20080249029A1-20081009-C00004
where n is 0-3, R, is H or C1-Saikyl and the carbonyl moiety of B is bound to E; E is a heterocycle selected from the group consisting of oxazolin-2-yl, oxazol-2-yl thiazol-2-yl, thiazol-5-yl, thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl, 4-oxo-2quinoxalin-2-yl, 2pyridyl, 3-pyridyl, benzo(b)thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl, 4,5,6,7-tetrahydrobenzothiazol-2yl, naphtho[2,1-dlthiazol-2-yl, naphtho[1-2-dlthiazoi-2-yl quinoxalin-2-yl, isoquinclin-1-yl, isoquinolin-3-yl, benzo [blfuran-2-yl [pyrazin-2-yl, quinazoiin-2-yl, isothiazol-5-yl, isothiazol-3yl, purin-8yul and a substituted heterocycle where the substituents are selected from C1-4alkyl, perfluoro C1-4alkyl C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4 dialkylamino, carboxy, C1-4alkoxycarbonyl, hydroxy or phenylC1-4alkylaminocarbonyl; or pharmaceutically acceptable salts thereof.
10. A method according to claim 9 wherein said compound contains a d-phenylalanine-proline-arginine sequence.
11. A method according to claim 10 wherein said compound is (S)-N-Methyl-D-phenylalanyl-N-[4-[(aminoiminomethyl)aminol-1-(2-benzothiazolylcarbonyl)butyl-L-prolinamide.
12-68. (canceled)
US11/929,488 1997-07-28 2007-10-30 Methods for Treating Skin Pigmentation Abandoned US20080249029A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/929,488 US20080249029A1 (en) 1997-07-28 2007-10-30 Methods for Treating Skin Pigmentation

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US5394297P 1997-07-28 1997-07-28
US8044198P 1998-04-02 1998-04-02
US09/110,409 US8039026B1 (en) 1997-07-28 1998-07-06 Methods for treating skin pigmentation
US11/929,488 US20080249029A1 (en) 1997-07-28 2007-10-30 Methods for Treating Skin Pigmentation

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/110,409 Division US8039026B1 (en) 1997-07-28 1998-07-06 Methods for treating skin pigmentation

Publications (1)

Publication Number Publication Date
US20080249029A1 true US20080249029A1 (en) 2008-10-09

Family

ID=27368528

Family Applications (3)

Application Number Title Priority Date Filing Date
US09/110,409 Expired - Fee Related US8039026B1 (en) 1997-07-28 1998-07-06 Methods for treating skin pigmentation
US11/929,488 Abandoned US20080249029A1 (en) 1997-07-28 2007-10-30 Methods for Treating Skin Pigmentation
US13/183,913 Abandoned US20120027706A1 (en) 1997-07-28 2011-07-15 Methods for treating skin pigmentation

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/110,409 Expired - Fee Related US8039026B1 (en) 1997-07-28 1998-07-06 Methods for treating skin pigmentation

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/183,913 Abandoned US20120027706A1 (en) 1997-07-28 2011-07-15 Methods for treating skin pigmentation

Country Status (20)

Country Link
US (3) US8039026B1 (en)
EP (1) EP0948308B1 (en)
JP (2) JP4401441B2 (en)
KR (1) KR100691395B1 (en)
CN (1) CN1234735B (en)
AR (1) AR016780A1 (en)
AT (1) ATE260083T1 (en)
AU (1) AU8756698A (en)
BR (2) BR9806118A (en)
CA (1) CA2267077C (en)
DE (1) DE69821913T2 (en)
DK (1) DK0948308T3 (en)
ES (1) ES2215317T3 (en)
HU (1) HUP0000216A3 (en)
ID (1) ID22061A (en)
IL (1) IL129090A0 (en)
PL (1) PL333284A1 (en)
PT (1) PT948308E (en)
TW (1) TW557216B (en)
WO (1) WO1999004752A2 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110081305A1 (en) * 2009-10-02 2011-04-07 Steven Cochran Compositions comprising a skin-lightening resorcinol and a skin darkening agent
US9289361B2 (en) 2009-10-02 2016-03-22 Johnson & Johnson Consumer Inc. Compositions comprising an NFκB-inhibitor and a non-retinoid collagen promoter
US9370474B2 (en) 2009-10-02 2016-06-21 Johnson & Johnson Consumer Inc. High-clarity aqueous concentrates of 4-hexylresorcinol
US9375395B2 (en) 2009-10-02 2016-06-28 Johnson & Johnson Consumer Inc. Compositions comprising an NFκB-inhibitor and a tropoelastin promoter
WO2018162645A1 (en) 2017-03-08 2018-09-13 Amazentis Sa Skin treatment methods
US10307352B2 (en) 2012-09-24 2019-06-04 Johnson & Johnson Consumer Inc. Low oil compositions comprising a 4-substituted resorcinol and a high carbon chain ester

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8039026B1 (en) 1997-07-28 2011-10-18 Johnson & Johnson Consumer Companies, Inc Methods for treating skin pigmentation
US8106094B2 (en) 1998-07-06 2012-01-31 Johnson & Johnson Consumer Companies, Inc. Compositions and methods for treating skin conditions
US8093293B2 (en) 1998-07-06 2012-01-10 Johnson & Johnson Consumer Companies, Inc. Methods for treating skin conditions
US6750229B2 (en) * 1998-07-06 2004-06-15 Johnson & Johnson Consumer Companies, Inc. Methods for treating skin pigmentation
BR0007778A (en) 1999-01-27 2002-06-04 Ortho Mcneil Pharm Inc Peptidyl heterocyclic ketones useful as tryptase inhibitors
US20020034772A1 (en) 1999-06-29 2002-03-21 Orlow Seth J. Methods and compositions that affect melanogenesis
US7985404B1 (en) 1999-07-27 2011-07-26 Johnson & Johnson Consumer Companies, Inc. Reducing hair growth, hair follicle and hair shaft size and hair pigmentation
BR0007404A (en) * 1999-11-05 2002-04-09 Johnson & Johnson Consumer Soy compositions for depigmentation and skin care
AU2012216795B2 (en) * 1999-11-05 2015-07-09 Johnson & Johnson Consumer Companies, Inc. Soy depigmenting and skin care compositions
US8431550B2 (en) * 2000-10-27 2013-04-30 Johnson & Johnson Consumer Companies, Inc. Topical anti-cancer compositions and methods of use thereof
US7192615B2 (en) * 2001-02-28 2007-03-20 J&J Consumer Companies, Inc. Compositions containing legume products
US6555143B2 (en) * 2001-02-28 2003-04-29 Johnson & Johnson Consumer Products, Inc. Legume products
US7025951B2 (en) 2002-06-18 2006-04-11 Johnson & Johnson Consumer Companies, Inc. Compositions and methods for darkening the skin
KR101156968B1 (en) * 2002-12-02 2012-06-20 포라 가세이 고교 가부시키가이샤 Dendrite elongation inhibitor for melanocyte and skin preparation for external use containing the same
JP4447466B2 (en) * 2002-12-03 2010-04-07 ポーラ化成工業株式会社 Melanocyte dendrite elongation inhibitor and skin external preparation containing the same
US9084734B2 (en) * 2005-05-05 2015-07-21 Danisco Us Inc. Peptide personal care compositions and methods for their use
FR2889808B1 (en) 2005-08-17 2011-07-22 Oreal USE OF 8-HEXADECENE-1,16-DICARBOXYLIC ACID AS A CARE AGENT TO PROMOTE COHESION OF THE CORNEA LAYER
JP5568008B2 (en) * 2007-06-27 2014-08-06 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー Peptide tyrosinase inhibitors and uses thereof
JP2010160145A (en) * 2008-12-12 2010-07-22 Daiichi Sankyo Healthcare Co Ltd Method for detecting melanosome transport
US9326930B2 (en) 2009-01-16 2016-05-03 Neocutis S.A. Calcium sequestration compositions and methods of treating skin pigmentation disorders and conditions
KR101286152B1 (en) * 2010-12-17 2013-07-15 계명대학교 산학협력단 Composition for Improving Vitiligo or Canities Comprising Extract from Glycine maxim As Active Ingredient
AU2012331140A1 (en) 2011-11-04 2014-05-08 Lipotec, S.A. Peptides which inhibit activated receptors and their use in cosmetic or pharmaceutical compositions
JP2014153878A (en) * 2013-02-07 2014-08-25 Nippon Telegr & Teleph Corp <Ntt> End-end personal identity guarantee system and method
JP6324777B2 (en) * 2014-03-18 2018-05-16 ポーラ化成工業株式会社 Collagen production promoter
EP3200683A4 (en) * 2014-09-29 2018-03-21 ELC Management LLC Actives for stimulating differentiation of keratinocytes to lighten hyperpigmented skin
SG11201805765QA (en) 2016-01-19 2018-08-30 Achromaz Pte Ltd A cosmetic composition and the use thereof for regulating skin quality
CN106619167A (en) * 2016-11-25 2017-05-10 南京泛成生物化工有限公司 Composition capable of whitening and brightening, preparation method thereof and application thereof in cosmetics
WO2021037759A1 (en) 2019-08-28 2021-03-04 Unilever Global Ip Limited Novel compounds for skin lightening
US20220313581A1 (en) 2019-08-28 2022-10-06 Conopco, Inc. , d/b/a UNILEVER Novel compounds for skin lightening

Citations (96)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2876164A (en) * 1957-08-01 1959-03-03 Dome Chemicals Inc Dermatological preparation containing defatted soy bean flour
US2924525A (en) * 1957-06-03 1960-02-09 Central Soya Co Poultry treatment for skin pigmentation
US4007266A (en) * 1968-05-03 1977-02-08 Choay S.A. Pharmaceutical composition containing vitamin B12, process of making the same and method of treatment
US4151304A (en) * 1976-11-05 1979-04-24 Lever Brothers Company Method and composition for moisturizing the skin
US4190671A (en) * 1977-03-17 1980-02-26 Biorex Laboratories Limited Chalcone derivatives
US4254105A (en) * 1975-10-11 1981-03-03 The Lion Dentifrice Co., Ltd. Multiple emulsion having a form of water/oil/water phase and process for preparation thereof, and multiple emulsion type cosmetics
US4331692A (en) * 1971-07-23 1982-05-25 Ulla Drevici Cocoa fruits and products
US4368187A (en) * 1981-08-03 1983-01-11 Eli Lilly And Company Sensitive-skin care regime
US4370315A (en) * 1977-02-22 1983-01-25 Sederma Post-depilatory composition reducing progressively the growth of body hair
US4382960A (en) * 1981-08-03 1983-05-10 Eli Lilly And Company Cosmetic cleanser formulation
US4386067A (en) * 1969-04-30 1983-05-31 Expanscience Cosmetic compositions
US4427670A (en) * 1980-03-27 1984-01-24 Mitsubishi Chemical Industries Limited Skin preparation
US4434095A (en) * 1979-02-04 1984-02-28 Institute Organicheskogo Sinteza Cyclic analogue of naturally-occurring phagocytosis-stimulant peptide - threonyl-cyclo-[-N.sup.ε -lysyl-prolyl-arginyl]
US4437895A (en) * 1981-07-23 1984-03-20 Societe Anonyme Dite: L'oreal Mixture of vegetable oils based on jojoba oil and cosmetic compositions comprising the mixture
US4439418A (en) * 1981-07-29 1984-03-27 Henkel Kgaa Topical preparations for the treatment of seborrhea and process for inhibiting sebum production
US4512973A (en) * 1983-10-12 1985-04-23 Genentech, Inc. Method for overcoming trypsin inhibition
US4515778A (en) * 1981-03-12 1985-05-07 Wolfgang Kastell Preparation for conditioning and grooming the hair
US4578267A (en) * 1981-09-15 1986-03-25 Morton Thiokol, Inc. Skin conditioning polymer containing alkoxylated nitrogen salts of sulfonic acid
US4584190A (en) * 1983-11-17 1986-04-22 Kao Corporation Novel chalcone derivatives and ultraviolet absorbers comprising the same
US4727088A (en) * 1984-02-06 1988-02-23 Neutrogena Corporation Retinoid composition having enhanced bioavailability and percutaneous absorption
US4824662A (en) * 1987-06-15 1989-04-25 Vi-Jon Laboratories, Inc. Nail polish remover
US4834076A (en) * 1985-04-17 1989-05-30 Millet Jean M Device for treating the external human epithelium, process for its manufacture and process for using such a device
US4895839A (en) * 1987-07-10 1990-01-23 INDENZA S.p.A. Pharmaceutical and cosmetic compositions containing complexes of flavanolignans with phospholipids
US4906457A (en) * 1988-09-06 1990-03-06 Washington State University Research Foundation, Inc. Compositions and methods for reducing the risk of sunlight and ultraviolet induced skin cancer
US5002761A (en) * 1988-05-02 1991-03-26 Henkel Kommanditgesellschaft Auf Aktien Hair treatment compositions containing natural ingredients
US5006337A (en) * 1987-04-16 1991-04-09 Marbert Gmbh Medicinal compositions based on spent brewers' grains extract, a process for the preparation thereof, and the use of spent brewers' grains extract for the preparation of cosmetic compositions, and a special brewers' grains extract
US5104655A (en) * 1987-07-27 1992-04-14 Indena S.P.A. Polyunsaturated acids having vasokinetic action and pharmaceutical and cosmetic formulations containing them
US5110603A (en) * 1991-01-31 1992-05-05 Kao Corporation Bathing preparation for colloidal material
US5179091A (en) * 1990-06-22 1993-01-12 Adir Et Compagnie Chalcones
US5188823A (en) * 1991-02-07 1993-02-23 Stepan Company Antiperspirant formulations
US5192332A (en) * 1983-10-14 1993-03-09 L'oreal Cosmetic temporary coloring compositions containing protein derivatives
US5194252A (en) * 1989-07-27 1993-03-16 Vijon Laboratories, Inc. Moisture retaining aftershave
US5276058A (en) * 1993-06-09 1994-01-04 Nippon Hypox Laboratories Incorporated 3,4-dihydroxychalcone derivatives
US5306444A (en) * 1990-08-24 1994-04-26 Shiseido Company Ltd. Washing composition capable of preventing and ameliorating skin irritation
US5393519A (en) * 1992-03-27 1995-02-28 Helene Curtis, Inc. Shampoo compositions
US5397497A (en) * 1992-08-07 1995-03-14 Solvay Fluor Und Derivate Gmbh Bath additive composition containing polyglycerol fatty acid ester mixture
US5407675A (en) * 1990-08-10 1995-04-18 Etemad-Moghadam; Parviz Method and composition for use on the scalp and eyebrow region of a subject
US5498420A (en) * 1991-04-12 1996-03-12 Merz & Co. Gmbh & Co. Stable small particle liposome preparations, their production and use in topical cosmetic, and pharmaceutical compositions
US5503832A (en) * 1994-02-15 1996-04-02 De Stoutz; Jean-Christian Method for extracting the soluble material from oil-bearing beans or seeds
US5505946A (en) * 1994-04-01 1996-04-09 Trustees Of Univ Of Pa Bowman-birk inhibitor concentrate compositions and methods for the treatment of pre-malignant tissue
US5510391A (en) * 1993-10-22 1996-04-23 Mayapple Holdings, Llc Method of treating blood vessel disorders of the skin using vitamin K
US5595984A (en) * 1991-11-25 1997-01-21 Richardson-Vicks Inc. Use of salicylic acid for regulating skin wrinkles and/or skin atrophy
US5601833A (en) * 1993-12-30 1997-02-11 L'oreal Protective, nutritive and/or firming composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof
US5603949A (en) * 1991-08-01 1997-02-18 Lvmh Recherche Use of a tocopherol phosphate or one of its derivatives, for the preparation of cosmetic or pharmaceutical compositions and compositions so obtained
US5605894A (en) * 1991-11-25 1997-02-25 Richardson-Vicks Inc. Compositions for regulating skin wrinkles and/or skin atrophy
US5607666A (en) * 1993-12-22 1997-03-04 L'oreal Cosmetic or dermatological powder, its preparation process and its uses
US5607692A (en) * 1993-12-30 1997-03-04 L'oreal Depigmenting composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof
US5614180A (en) * 1993-08-30 1997-03-25 Helene Curtis, Inc. Shampoo-conditioner composition
US5614215A (en) * 1993-12-30 1997-03-25 L'oreal Cosmetic composition for the simultaneous treatment of the surface and deep layers of the skin, its use
US5618522A (en) * 1995-01-20 1997-04-08 The Procter & Gamble Company Emulsion compositions
US5620692A (en) * 1993-12-23 1997-04-15 Nurture, Inc. Oat oil compositions with useful cosmetic and dermatological properties
US5712356A (en) * 1993-11-26 1998-01-27 Ciba Vision Corporation Cross-linkable copolymers and hydrogels
US5723148A (en) * 1995-01-05 1998-03-03 Novartis Corp. Topical pharmaceutical compositions
US5741496A (en) * 1993-09-21 1998-04-21 Laboratoires De Biologie Vegetale Yves Rocher Process for the treatment of skins having dry areas and greasy areas
US5863546A (en) * 1997-03-02 1999-01-26 Swinehart; James M Cosmetic composition
US5869031A (en) * 1995-03-23 1999-02-09 Pierre Fabre Dermo-Cosmetique Depigmenting dermatological and/or cosmetic composition
US5871823A (en) * 1996-06-19 1999-02-16 Huels Aktiengesellschaft Hydrophilic coating of surfaces of polymeric substrates
US5871743A (en) * 1996-10-31 1999-02-16 Chajuss; Daniel Topical application of soy molasses
US5880314A (en) * 1995-11-24 1999-03-09 Mitsui Chemicals, Inc. Hydrochalcone derivatives, cosmetic compositions containing said derivatives and methods of producing the same
US5885593A (en) * 1995-09-28 1999-03-23 The Andrew Jergens Company Skin care composition including cyclodextrin materials and method for treating skin therewith
US5885600A (en) * 1997-04-01 1999-03-23 Burlington Bio-Medical & Scientific Corp. Natural insect repellent formula and method of making same
US5885617A (en) * 1994-07-12 1999-03-23 Bpsi Holdings, Inc. Moisture barrier film coating composition, method, and coated form
US5885948A (en) * 1995-02-15 1999-03-23 The Procter & Gamble Company Crystalline hydroxy waxes as oil in water stabilizers for skin cleansing liquid composition
US5885596A (en) * 1997-07-23 1999-03-23 Bristol-Myers Squibb Company Methods and compositions for fine lines and/or wrinkles
US5888522A (en) * 1996-08-23 1999-03-30 Skin Biology, Inc. Tissue protective and regenerative compositions
US6013250A (en) * 1995-06-28 2000-01-11 L'oreal S. A. Composition for treating hair against chemical and photo damage
US6013255A (en) * 1994-04-18 2000-01-11 Gist-Brocades B.V. Stable water-in-oil emulsions
US6018001A (en) * 1997-01-23 2000-01-25 Menicon Co., Ltd. Process for producing contact lens with hydrophilic surface and contact lens obtained thereby
US6017549A (en) * 1997-09-30 2000-01-25 E-L Management Corp. Non-irritating cosmetic and pharmaceutical compositions
US6017893A (en) * 1997-08-29 2000-01-25 Natures Sunshine Products, Inc. Use of isoflavones to prevent hair loss and preserve the integrity of existing hair
US6019962A (en) * 1995-11-07 2000-02-01 The Procter & Gamble Co. Compositions and methods for improving cosmetic products
US6030931A (en) * 1998-02-03 2000-02-29 Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. Foaming cleansing skin product
US6033680A (en) * 1994-12-06 2000-03-07 The Procter & Gamble Company Shelf stable skin cleansing liquid with gel forming polymer and lipid
US6045779A (en) * 1994-02-18 2000-04-04 Henkel Kommanditgesellschaft Auf Aktien Skin and hair aerosol foam preparations containing an alkyl polyglycoside and vegetable oil
US6048520A (en) * 1992-09-24 2000-04-11 Helene Curtis, Inc. Clear leave-on hair treatment composition and method
US6051602A (en) * 1998-03-16 2000-04-18 The Procter & Gamble Company Methods for regulating skin appearance
US6054137A (en) * 1997-12-19 2000-04-25 Societe L'oreal S.A. Promoting epidermal renewal with phloroglucinol
US6180662B1 (en) * 1994-12-13 2001-01-30 Beiersdorf Ag Agents acting against hyperreactive and hypoactive, deficient skin conditions and manifest dermatitides
US6183762B1 (en) * 1997-05-27 2001-02-06 Sembiosys Genetics Inc. Oil body based personal care products
US6183761B1 (en) * 1998-03-16 2001-02-06 The Procter & Gamble Company Compositions for regulating skin appearance
US20020035046A1 (en) * 1999-07-01 2002-03-21 Lukenbach Elvin R. Personal care compositions
US20020034489A1 (en) * 1999-06-10 2002-03-21 Benjamin Wiegland Personal care formulations
US20030064048A1 (en) * 1999-07-27 2003-04-03 Miri Seiberg Reducing hair growth, hair follicle and hair shaft size and hair pigmentation
US20030064049A1 (en) * 2000-10-27 2003-04-03 Miri Seiberg Topical anti-cancer compositions and methods of use thereof
US6551606B1 (en) * 1999-06-10 2003-04-22 Coty B.V. Cosmetic product containing enzymes
US6555143B2 (en) * 2001-02-28 2003-04-29 Johnson & Johnson Consumer Products, Inc. Legume products
US20040009142A1 (en) * 2000-07-26 2004-01-15 Marie-France Zambaux Synergistically active mixture which inhibits hair growth
US20040062731A1 (en) * 2000-10-27 2004-04-01 Miri Seiberg Topical anti-cancer compositions and methods of use thereof
US20040063593A1 (en) * 2002-09-30 2004-04-01 Wu Jeffrey M. Compositions containing a cosmetically active organic acid and a legume product
US20040067244A1 (en) * 1999-03-22 2004-04-08 Friedman Doron I. Nano oil in glycerin emulsion
US20050004561A1 (en) * 2003-07-01 2005-01-06 Lynn Halas Method for removing hair
US20050008665A1 (en) * 2001-10-13 2005-01-13 Beiersdorf Ag Cosmetic or dermatological active ingredient combination
US20050019279A1 (en) * 2001-11-09 2005-01-27 Beiersdorf Ag Cosmetic or dermatological preparation containing an octadecene dioic acid and a UV filtering substance
US20050036963A1 (en) * 1998-07-06 2005-02-17 Archana Sah Compositions and methods for treating skin conditions
US20070009459A1 (en) * 2003-08-26 2007-01-11 Stephanie Magnant Stabilized antiperspirant compositions containing soy products
US20070041931A1 (en) * 2003-10-29 2007-02-22 Muriel Morelli Compositions Comprising Soy Products and Dioic Acids

Family Cites Families (270)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3097947A (en) 1961-01-30 1963-07-16 Mend Johnson & Company Nutritional composition and process
US3395214A (en) 1964-01-09 1968-07-30 Scholl Mfg Co Inc Antiperspirant composition providing a readily collapsible sprayable foam
US3625976A (en) 1969-12-09 1971-12-07 Int Flavors & Fragrances Inc Coumarin ether sun-screening compounds
US3755560A (en) 1971-06-30 1973-08-28 Dow Chemical Co Nongreasy cosmetic lotions
US4056637A (en) 1976-06-08 1977-11-01 Japan Natural Food Co. Ltd. Process for preparing food products containing a lactic acid bacteria-fermented product of a cereal germ
US4279930A (en) 1978-10-10 1981-07-21 The Upjohn Company Process for treating inflammation
US4219569A (en) 1978-10-10 1980-08-26 The Upjohn Company Process for treating inflammation
US4223018A (en) 1979-02-09 1980-09-16 Jimmie Belle Bath composition
DE3040246C2 (en) 1979-10-29 1985-01-10 Osaka Chemical Laboratory Co., Ltd., Osaka Soy Saponins A &darr; 1 &darr; and A? 2? and their use
US4297348A (en) 1980-04-11 1981-10-27 Rush-Hampton Industries, Inc. Composition and method for the treatment of acne
US5439672A (en) 1980-07-01 1995-08-08 L'oreal Cosmetic composition based on an aqueous dispersion of small lipid spheres
US4272544A (en) 1980-08-20 1981-06-09 Eli Lilly And Company Skin cell renewal regime
US4278570A (en) 1980-08-20 1981-07-14 Eli Lilly And Company Cosmetic cleanser formulation
LU83020A1 (en) 1980-12-19 1982-07-07 Oreal OIL COMPOSITION FOR THE TREATMENT OF KERATINIC MATERIALS AND THE SKIN
US4603146A (en) 1984-05-16 1986-07-29 Kligman Albert M Methods for retarding the effects of aging of the skin
US4859458A (en) 1981-09-15 1989-08-22 Morton Thiokol, Inc. Hair conditioning polymers containing alkoxylated nitrogen salts of sulfonic acid
US4421769A (en) 1981-09-29 1983-12-20 The Procter & Gamble Company Skin conditioning composition
FR2514643B1 (en) 1981-10-20 1986-07-04 Oreal COPPER LANOLATE AND ANTI-ACNE COSMETIC COMPOSITIONS CONTAINING THE SAME
FR2520253A1 (en) 1982-01-28 1983-07-29 Oreal NOVEL EMULSIFYING SYSTEM BASED ON PROTEIN CONDENSATION, POLYOXYETHYLENE STEROL AND PHOSPHATIDE AND USE THEREOF IN COSMETICS
US4477434A (en) 1982-05-29 1984-10-16 Reiko Kosaka Medicinal compositions, foods and beverages having therapeutic effects on diseases of circulatory system and digestive system
US4462981A (en) 1982-12-10 1984-07-31 Creative Products Resource, Associates Ltd. Cosmetic applicator useful for skin moisturizing and deodorizing
US4550035A (en) 1982-12-10 1985-10-29 Creative Products Resource Associates, Ltd. Cosmetic applicator useful for skin moisturizing and deodorizing
US4604281A (en) 1983-03-21 1986-08-05 Charles Of The Ritz Group Ltd. Cosmetic and skin treatment compositions containing acetylated sterols
DE3326455A1 (en) 1983-07-22 1985-01-31 Henkel Kgaa COSMETIC-PHARMACEUTICAL OIL COMPONENTS
JPS6061513A (en) 1983-09-14 1985-04-09 Sansho Seiyaku Kk Cosmetic
IT1180156B (en) 1984-01-09 1987-09-23 Crinos Industria Farmaco GLYCOPROTEIN-BASED COSMETIC COMPOSITION FOR SKIN TREATMENT
US4690821A (en) 1984-02-10 1987-09-01 Creative Products Resource Associates, Ltd. Towel for skin moisturizing and drying
ATE81449T1 (en) 1984-03-05 1992-10-15 Tonfer Inc CLEANING SUPPLIES.
AU580645B2 (en) 1984-12-21 1989-01-19 Kibun Company Limited Process of producing soy bean milk
US4760096A (en) 1985-09-27 1988-07-26 Schering Corporation Moisturizing skin preparation
US4793991A (en) 1986-01-31 1988-12-27 Slimak Karen M Hypoallergenic cosmetics, lip balms and lip sticks
US4970216A (en) 1986-03-17 1990-11-13 Richardson Vicks, Inc. Skin treatment composition and method
US4847267A (en) 1986-03-17 1989-07-11 Charles Of The Ritz Group Ltd. Skin treatment composition and method
LU86361A1 (en) 1986-03-19 1987-11-11 Oreal AQUEOUS COSMETIC COMPOSITION WITH DIFFERENT FOAM FOR THE TREATMENT OF HAIR AND SKIN
FR2641696B2 (en) 1986-04-11 1991-03-08 Sederma Sa USE OF A MIXTURE CONTAINING LACTOFERRIN IN FREE ANTI-RADICAL COSMETIC PREPARATIONS
FR2596986B1 (en) 1986-04-11 1988-09-23 Sederma Sa USE OF LACTOFERRIN IN COSMETIC, FREE ANTIRADICAL PREPARATIONS
FR2600250B1 (en) 1986-06-23 1989-11-24 Bio Serae PROCESS FOR PACKAGING AN ANTIBACTERIAL COMPOSITION AND PACKAGED ANTIBACTERIAL COMPOSITION
JPS63135310A (en) 1986-11-27 1988-06-07 Lion Corp Cosmetic
LU86715A1 (en) 1986-12-16 1988-07-14 Oreal COSMETIC COMPOSITION CONTAINING HYDROXYLATED CHALCON DERIVATIVES AND ITS USE FOR PROTECTING SKIN AND HAIR AGAINST LIGHT RADIATION, NEW HYDROXYLATED CHALCON DERIVATIVES AND THEIR PREPARATION METHOD
AU618517B2 (en) 1986-12-23 1992-01-02 Eugene J. Van Scott Additives enhancing topical actions of therapeutic agents
IT1201149B (en) 1987-01-14 1989-01-27 Indena Spa BIOFLAVONOID COMPLEXES WITH PHOSPHOLIPIDS, THEIR PREPARATION, USE AND PHARMACEUTICAL AND COSMETIC COMPOSITIONS
US5166139A (en) 1987-02-26 1992-11-24 Indena, S.P.A. Complexes of saponins and their aglycons with phospholipids and pharmaceutical and cosmetic compositions containing them
IT1203515B (en) 1987-02-26 1989-02-15 Indena Spa SAPONINE COMPLEXES WITH PHOSPHOLIPIDS AND PHARMACEUTICAL AND COSMETIC COMPOSITIONS CONTAINING THEM
US4960764A (en) 1987-03-06 1990-10-02 Richardson-Vicks Inc. Oil-in-water-in-silicone emulsion compositions
US5688763A (en) 1987-06-12 1997-11-18 Hammonds, Jr.; R. Glenn Compositions and methods for the synthesis of growth hormone receptor and growth hormone binding protein
US5057417A (en) 1987-06-12 1991-10-15 Genentech, Inc. Compositions and methods for the synthesis of growth hormone receptor and growth hormone binding protein
LU86997A1 (en) 1987-09-21 1989-04-06 Oreal PHOTOSTABLE FILTERING COSMETIC COMPOSITION CONTAINING BIXIN ASSOCIATED WITH A LIPOSOLUBLE UV FILTER AND ITS USE FOR THE PROTECTION OF THE HUMAN SKIN AGAINST ULTRAVIOLET RADIATION
JP2618657B2 (en) 1987-10-02 1997-06-11 株式会社資生堂 External preparation for anti-pigmentation
JPH0196106A (en) 1987-10-09 1989-04-14 Shiseido Co Ltd External drug for skin
US4915972A (en) * 1988-01-05 1990-04-10 Prosoya Corporation Food processing in oxygen-free environment
CH676470A5 (en) 1988-02-03 1991-01-31 Nestle Sa
FR2628317B1 (en) 1988-03-09 1991-11-08 Lvmh Rech COMPOSITION BASED ON HYDRATED LIPID LAMID PHASES OR LIPOSOMES CONTAINING SCUTELLARIA EXTRACT, OR AT LEAST ONE FLAVONOID SUCH AS BAICALINE OR BAICALINE AND COSMETIC OR PHARMACEUTICAL COMPOSITION, IN PARTICULAR DERMATOLOGICAL, ANTI-ALLERGIC ANTI-ALLERGIC ACTIVITY THE INCORPORANT
IT1219587B (en) 1988-05-13 1990-05-18 Fidia Farmaceutici SELF-CROSS-LINKED CARBOXYLY POLYSACCHARIDES
US4851214A (en) 1988-09-07 1989-07-25 Ici Americas Inc. Deodorants containing N-soya-N-ethyl morpholinium ethosulfate
US4960588A (en) 1988-11-16 1990-10-02 Helene Curtis, Inc. Hair treatment compositions to impart durable hair set retention properties
US4943462A (en) 1989-01-17 1990-07-24 Semex Medical, Inc. Nail treatment device
LU87449A1 (en) 1989-02-09 1990-09-19 Oreal PROCESS FOR THE MANUFACTURE OF FOAMS FOR USE IN THE COSMETIC AND PHARMACEUTICAL AREAS AND FOAMS OBTAINED BY THIS PROCESS
US5116605A (en) 1989-03-09 1992-05-26 Alt John P Composition and skin treatment method therewith for mitigating acne and male-pattern baldness
AU631425B2 (en) 1989-04-14 1992-11-26 Wesley-Jessen Corporation Color binding mechanism for contact lenses
MY105521A (en) 1989-04-17 1994-10-31 Healthpoint Ltd Moisturizing vehicle for topical application of vitamin a acid.
US5077038A (en) 1989-07-27 1991-12-31 Vi-Jon Laboratories, Inc. Nail polish remover
EP0443005A4 (en) 1989-09-14 1992-02-19 Sing-Hsiung Chang Soft gas permeable contact lens having improved clinical performance
JP2832848B2 (en) 1989-10-21 1998-12-09 株式会社林原生物化学研究所 Crystal 2-O-α-D-glucopyranosyl-L-ascorbic acid, its production method and use
EP0421021A1 (en) 1989-10-06 1991-04-10 MUCOS EMULSIONSGESELLSCHAFT m.b.H. Use of catabolic enzymes to activate macrophages and/or NK cells, medicinal composition containing these enzymes for the activation of macrophages and/or NK cells
US5554647A (en) 1989-10-12 1996-09-10 Perricone; Nicholas V. Method and compositions for treatment and/or prevention of skin damage and aging
US5032400A (en) 1989-11-02 1991-07-16 Erie Laboratories Shark liver oil and garlic oil topical analgesic
US5834312A (en) 1990-01-29 1998-11-10 Hy-Gene, Inc. Process and media for the growth of human epithelia
US5622690A (en) 1990-04-05 1997-04-22 Nurture, Inc. Seed-derived proteinaceous compositions for reduction of sunburn cell formation
US5077040A (en) 1990-04-30 1991-12-31 Helene Curtis, Inc. Hair-treating microemulsion composition and method of preparing and using the same
US5332758A (en) 1990-07-13 1994-07-26 Kanebo, Ltd. Collagen metabolism ameliorant and its use
CA2047160C (en) 1990-07-25 2002-06-25 Masahiro Ito Reactive hot-melt elastic sealant composition
US5231090A (en) 1990-07-30 1993-07-27 University Of Miami Treatment for hypercholesterolemia
JPH04169520A (en) * 1990-11-01 1992-06-17 Shiseido Co Ltd Skin detergent composition
FR2666474B1 (en) 1990-08-28 1992-11-06 De Stoutz Jean DEVICE FOR HEATING FLUIDS BY JOUL EFFECT.
US5217717A (en) 1990-09-06 1993-06-08 Central Soya Company, Inc. Method of making soybean Bowman-Birk inhibitor concentrate and use of same as a human cancer preventative and therapy
US5130142A (en) 1990-10-31 1992-07-14 The Practer & Gamble Company Hair growth regulating composition comprising epithelium cell supernatant-derived growth factor
JP3032566B2 (en) * 1990-11-01 2000-04-17 株式会社資生堂 External preparation for skin
DE69107056D1 (en) 1990-11-14 1995-03-09 Oreal AMPHIPHILES, NON-IONIC DERIVATIVES OF GLYCERINE AND THE CORRESPONDING INTERMEDIATE PRODUCTS, METHOD FOR THE PRODUCTION THEREOF AND THE COMPOSITIONS CONTAINING THE SAME.
CA2095046C (en) 1990-11-27 2003-01-28 Paul L. Valint, Jr. Surface-active macromonomers
US5135297A (en) 1990-11-27 1992-08-04 Bausch & Lomb Incorporated Surface coating of polymer objects
US5449794A (en) 1991-02-15 1995-09-12 Jasmine Fockerman Benzopyran phenol derivatives for use as antibacterial agents
GB9104286D0 (en) 1991-02-28 1991-04-17 Phytopharm Ltd Pharmaceutical compositions for the treatment of skin disorders
US5807543A (en) 1993-08-27 1998-09-15 The Procter & Gamble Co. Cosmetic compositions containing hydrophobically modified nonionic polymer and unsaturated quaternary ammonium surfactant
JPH05114905A (en) 1991-04-08 1993-05-07 Digital Equip Corp <Dec> Message processing filtering using single address and protocol table bridge
US5229104A (en) 1991-04-29 1993-07-20 Richardson-Vicks Inc. Artificial tanning compositions containing positively charged paucilamellar vesicles
EP0514576A1 (en) 1991-05-24 1992-11-25 Societe Des Produits Nestle S.A. Oil-soluble antioxidant mixture
US5310734A (en) 1991-07-05 1994-05-10 Rhone-Poulenc Rorer Phospholipid composition
JP3320430B2 (en) 1991-07-10 2002-09-03 日本原子力研究所 Method for producing sterile phospholipid, aqueous phospholipid dispersion or aqueous liposome dispersion by radiation sterilization
FR2679446B1 (en) 1991-07-24 1993-10-29 Oreal METHOD FOR MANUFACTURING A COSMETIC COMPOSITION FOR APPLICATION TO HAIR, COMPOSITION OBTAINED BY THIS PROCESS AND METHOD FOR COSMETIC TREATMENT USING THE SAME.
US5254331A (en) 1991-09-12 1993-10-19 Chanel, Inc. Skin cream composition
EP0532465B1 (en) * 1991-09-13 2002-07-10 Pentapharm A.G. Protein fraction for cosmetic and dermatological care of the skin
US5260065A (en) 1991-09-17 1993-11-09 Micro Vesicular Systems, Inc. Blended lipid vesicles
US5780459A (en) 1991-11-25 1998-07-14 The Procter & Gamble Company Compositions for regulating skin wrinkles and or skin atrophy
FR2685202B1 (en) 1991-12-24 1995-03-24 Sederma Sa NOVEL PHARMACEUTICAL AND COSMETIC TREATMENT METHOD FOR THE REGULATION OF SEBORRHEA, ACNE AND SKIN FLORA.
FR2687314A1 (en) 1992-02-18 1993-08-20 Oreal LIPID VESICLE DISPERSION, COSMETIC AND / OR PHARMACEUTICAL COMPOSITION CONTAINING THE SAME, AND PROCESS FOR THE PREPARATION OF SAID DISPERSION.
US5766628A (en) 1992-02-24 1998-06-16 Merz + Co. Gmbh & Co. Bath and shower composition having vesicle-forming properties and method for the production and use thereof
DE4206090C2 (en) 1992-02-27 1998-02-05 Perycut Chemie Ag Insect repellent
US5322689A (en) 1992-03-10 1994-06-21 The Procter & Gamble Company Topical aromatic releasing compositions
US5248495A (en) 1992-04-16 1993-09-28 The Procter & Gamble Company Post foaming shaving gel composition
EP0574352A1 (en) 1992-06-09 1993-12-15 Ciba-Geigy Ag Process for graft polymerization on surfaces of preformed substrates to modify surface properties
US5352443A (en) 1992-06-15 1994-10-04 Shiseido Co., Ltd. Permanent waving composition
FR2692783B1 (en) 1992-06-25 1995-05-05 Expanchimie Compositions based on unsaponifiable fractions of wheat germ and sesame oils, and their uses in particular in cosmetology and as a food supplement.
US5643601A (en) 1992-06-26 1997-07-01 Lancaster Group Ag Phospholipid-and fluorocarbon-containing cosmetic
US5641509A (en) 1992-06-26 1997-06-24 Lancaster Group Ag Preparation for topical use
DE4221256C2 (en) 1992-06-26 1997-07-10 Lancaster Group Ag Galenic composition for topical use
US5438044A (en) 1992-06-30 1995-08-01 Rhone-Poulenc Rorer Phospholipid composition
ES2136105T3 (en) 1992-08-04 1999-11-16 Rhone Poulenc Rorer Gmbh PHARMACEUTICAL AND / OR COSMETIC PREPARATION.
FR2694934B1 (en) 1992-08-24 1994-11-10 Oreal Composition for the treatment of acne containing a salicylic acid derivative and salicylic acid derivatives.
JPH06192085A (en) 1992-08-31 1994-07-12 Yuji Inada Therapeutic agent for mite allergy
IL106922A (en) 1992-09-14 1998-08-16 Novartis Ag Composite materials with one or more wettable surfaces and process for their preparation
US5753612A (en) 1992-10-27 1998-05-19 Yissum Research Development Co. Of The Hebrew University Of Jerusalem Pharmaceutical composition and method for inhibiting hair growth by administration of activin or activin agonists
JP3257091B2 (en) 1992-11-06 2002-02-18 不二製油株式会社 Anti-skin cancer agent or food
US5565439A (en) 1992-11-24 1996-10-15 The Procter & Gamble Company Methods of using lysophosphatidic acid for treating hyperproliferative conditions
JP2580942B2 (en) 1992-12-24 1997-02-12 ティアック株式会社 Magnetic tape device and method of moving the magnetic head
US5270042A (en) 1993-02-23 1993-12-14 Juanita Whitham Medicinal salve composition
RU2066992C1 (en) 1993-03-01 1996-09-27 Надежда Михайловна Остроумова Method and remedy for removing hairs
JP3091045B2 (en) * 1993-03-04 2000-09-25 丸善製薬株式会社 Skin cosmetics
CA2119064A1 (en) 1993-03-17 1994-09-18 Richard A. Berg Dermal-epidermal in vitro test system
CN1081899A (en) 1993-04-24 1994-02-16 王丽华 Broad-spectrum ointment
TW253849B (en) 1993-08-09 1995-08-11 Ciba Geigy
FR2709756B1 (en) 1993-09-10 1995-10-20 Essilor Int Hydrophilic, transparent material with high oxygen permeability, based on a polymer with interpenetrating networks, its method of preparation and manufacture of soft contact lenses with high oxygen permeability.
FR2710524B1 (en) 1993-09-28 1995-11-17 Oreal Composition of nail polish containing an epoxidized oil as a plasticizer.
US5641863A (en) 1993-09-30 1997-06-24 University Of Pennsylvania Chimeric IgG Fc receptors
IL111105A (en) 1993-09-30 2009-05-04 Univ Pennsylvania Use of a molecule capable of inhibiting the expression of syk kinase to prepare a pharmaceutical composition for inhibiting phagocytosis
US5681571A (en) 1993-10-08 1997-10-28 Duotol Ab Immunological tolerance-inducing agent
JPH07121869B2 (en) 1993-10-12 1995-12-25 浩 前田 Inhibitors of inflammatory edema promotion
GB9322007D0 (en) 1993-10-26 1993-12-15 Unilever Plc Cosmetic composition
US5681852A (en) 1993-11-12 1997-10-28 The Procter & Gamble Company Desquamation compositions
EP0655470B1 (en) 1993-11-26 1999-05-12 Novartis AG Cross-linkable copolymers and hydrogels
DE4343431C1 (en) 1993-12-18 1995-05-04 Henkel Kgaa Cosmetic and/or pharmaceutical compositions
JPH07196529A (en) 1993-12-29 1995-08-01 Morinaga Milk Ind Co Ltd Wound-curing agent, cosmetic and hair tonic
JPH07196527A (en) 1993-12-29 1995-08-01 Morinaga Milk Ind Co Ltd Peptide or its derivative and cell growth activator
FR2714602B1 (en) 1993-12-30 1996-02-09 Oreal Anti-acne composition for the simultaneous treatment of the superficial and deep layers of the skin, its use.
FR2714604B1 (en) 1993-12-30 1996-01-26 Oreal Use of a spin acceptor in a cosmetic or dermatological composition.
FR2714599B1 (en) 1993-12-30 1996-02-09 Oreal Composition for fighting against aging, acting simultaneously on the superficial and deep layers of the skin, its use.
FR2714597B1 (en) 1993-12-30 1996-02-09 Oreal Moisturizing composition for the simultaneous treatment of the superficial and deep layers of the skin, its use.
FR2714598B1 (en) 1993-12-30 1996-02-09 Oreal Slimming composition with two types of liposomes for topical treatment, its use.
JPH0899891A (en) * 1994-01-21 1996-04-16 Pola Chem Ind Inc Skin external agent
US5468473A (en) 1994-02-09 1995-11-21 Innova Products, Inc. Antiperspirant for hands and feet
IL112649A (en) 1994-02-22 1999-12-22 Curtis Helene Ind Inc Topically effective compositions for application to the skin or hair
US5547661A (en) 1994-02-22 1996-08-20 Helene Curtis, Inc. Antiperspirant deodorant compositions
FR2717075B1 (en) 1994-03-14 1996-04-05 Oreal Aqueous organopolysiloxane makeup gel.
US5455234A (en) 1994-03-16 1995-10-03 Ahluwalia; Gurpreet S. Inhibition of hair growth
FR2719219B1 (en) 1994-05-02 1996-06-21 Rocher Yves Biolog Vegetale Cosmetic or pharmaceutical composition for topical use comprising lipid vesicles.
JP3127713B2 (en) 1994-05-10 2001-01-29 株式会社村田製作所 Optimal condition analysis method for powder molding
JPH07304655A (en) 1994-05-13 1995-11-21 Kikkoman Corp Bathing agent and its production
FR2720937B1 (en) 1994-06-08 1997-03-28 Oreal Cosmetic or dermatological composition in the form of an aqueous and stable dispersion of cubic gel particles based on phytantriol and containing a fatty chain surfactant as a dispersing and stabilizing agent.
FR2720934B1 (en) 1994-06-14 1996-07-12 Oreal Oil-in-water cleaning emulsion with the appearance of milk.
JPH0812560A (en) 1994-06-29 1996-01-16 Shiseido Co Ltd Skin external preparation
DE4424210C2 (en) 1994-07-09 1997-12-04 Beiersdorf Ag Use of compositions containing surfactants and containing oil components, which are otherwise water-free, as cosmetic or dermatological shower oils
US5444092A (en) 1994-07-20 1995-08-22 Collins; Jerry Method and composition for treating psoriasis
JPH0859450A (en) 1994-08-18 1996-03-05 Kose Corp External preparation for skin
DE4432947C2 (en) 1994-09-16 1998-04-09 New Standard Gmbh Agent for the treatment of the skin and its use
DE4433071C1 (en) 1994-09-16 1995-12-21 Henkel Kgaa Mild detergent mixtures
US5554608A (en) 1994-09-28 1996-09-10 Ahluwalia; Gurpreet S. Inhibition of hair growth
JPH08143442A (en) 1994-11-16 1996-06-04 Kikkoman Corp Skin external preparation and its production
US5567420A (en) 1994-11-16 1996-10-22 Mceleney; John Lotion which is temporarily colored upon application
JP3647093B2 (en) 1994-11-17 2005-05-11 株式会社メニコン Hydrophilized oxygen permeable contact lens and method for producing the same
CN1169112A (en) 1994-12-06 1997-12-31 普罗克特和甘保尔公司 Shelf stable skin cleansing liquid with gel forming polymer lipid and crystalling ethylene glycol fatty acid ester
PL182804B1 (en) 1995-02-07 2002-03-29 Fidia Advanced Biopolymers Method of coating objects with hialuronic acid, its derivatives and semi-synthetic polymers
FR2730928B1 (en) 1995-02-23 1997-04-04 Oreal COMPOSITION BASED ON LIPIDIC VESICLES WITH ACIDIC PH AND USE THEREOF IN TOPICAL APPLICATION
AU697323B2 (en) 1995-03-23 1998-10-01 Lancaster Group Gmbh Cosmetic with condensates of plant and animal decomposition products
FR2733148B1 (en) 1995-04-20 1997-05-30 Oreal COMPOSITION FOR FIGHTING AGAINST SPOTS AND / OR AGING OF THE SKIN, USES THEREOF
GB9510833D0 (en) 1995-05-27 1995-07-19 Procter & Gamble Cleansing compositions
US5942479A (en) 1995-05-27 1999-08-24 The Proctor & Gamble Company Aqueous personal cleansing composition with a dispersed oil phase comprising two specifically defined oil components
US5985809A (en) 1995-05-27 1999-11-16 The Procter & Gamble Company Aqueous personal cleansing compositions comprising specific nonocclusive liquid polyol fatty acid polyester
JP3911642B2 (en) 1995-06-06 2007-05-09 株式会社加美乃素本舗 Topical skin preparation
AU723595B2 (en) 1995-06-07 2000-08-31 University Of Pennsylvania Methods of inhibiting phagocytosis
US5523308A (en) * 1995-06-07 1996-06-04 Costanzo; Michael J. Peptidyl heterocycles useful in the treatment of thrombin related disorders
US5639785A (en) 1995-06-07 1997-06-17 Global Pharma, Ltd. Methods for the treatment of baldness and gray hair using isoflavonoid derivatives
CA2223747A1 (en) 1995-06-07 1996-12-19 Taisho Pharmaceutical Co., Ltd. Antifungal compositions
JPH0840824A (en) 1995-06-21 1996-02-13 Nonogawa Shoji Kk Cosmetic
ES2110857T3 (en) 1995-06-21 1998-02-16 Oreal COSMETIC COMPOSITION THAT INCLUDES A DISPERSION OF PARTICLES OF POLYMER.
US6126933A (en) 1995-06-27 2000-10-03 Genetics Institute Methods of treating inflammatory bowel diseases by administering IL-11
CN1146876A (en) 1995-06-28 1997-04-09 李缯宏 Beauty bean milk
JP3410870B2 (en) 1995-07-13 2003-05-26 株式会社資生堂 External preparation for skin
JPH0925213A (en) 1995-07-13 1997-01-28 Shiseido Co Ltd Skin preparation for external use
JPH0925212A (en) 1995-07-13 1997-01-28 Shiseido Co Ltd Skin preparation for external use
US5571503A (en) 1995-08-01 1996-11-05 Mausner; Jack Anti-pollution cosmetic composition
US5874127A (en) 1995-08-16 1999-02-23 Ciba Vision Corporation Method and apparatus for gaseous treatment
JPH0977638A (en) 1995-09-19 1997-03-25 Art Beauty Clinic Kk Foundation for cosmetic
US6063398A (en) 1995-09-20 2000-05-16 L'oreal Cosmetic or dermopharmaceutical patch containing, in an anhydrous polymeric matrix, at least one active compound which is, in particular, unstable in oxidizing mediums, and at least one water-absorbing agent
US5683683A (en) 1995-09-21 1997-11-04 Helene Curtis, Inc. Body wash composition to impart conditioning properties to skin
US5635165A (en) 1995-09-27 1997-06-03 Helene Curtis, Inc. Antiperspirant deodorant compositions
EP0798305B1 (en) 1995-10-17 2007-10-03 Showa Denko Kabushiki Kaisha High-purity tocopherol phosphates, process for the preparation thereof, method for analysis thereof, and cosmetics
NZ299379A (en) 1995-10-27 1997-04-24 Unilever Plc Topical flavanone-containing composition
US6238678B1 (en) 1995-11-06 2001-05-29 The Procter & Gamble Company Methods of regulating skin appearance with vitamin B3 compound
US6509098B1 (en) 1995-11-17 2003-01-21 Massachusetts Institute Of Technology Poly(ethylene oxide) coated surfaces
US5961980A (en) 1996-01-18 1999-10-05 The Trustees Of The University Of Pennsylvania Bowman-birk inhibitor compositions and methods for the treatment of genitourinary diseases
US5643587A (en) 1996-02-15 1997-07-01 Avon Products, Inc. Composition and method for under-eye skin lightening
WO1997035998A1 (en) * 1996-03-28 1997-10-02 Trustees Of Boston University Methods of modulating melanin synthesis
AU1793397A (en) 1996-03-29 1997-10-22 S.W. Patentverwertungs Ges. M.B.H. Edelsbacher U. Partner Cosmetic or cosmetic preparation for smoothing and tightening the skin in the case of subcutaneous fatty tissue problems, particularly cellulite
FR2747568B1 (en) 1996-04-17 1999-09-17 Oreal USE OF AT LEAST ONE LIPOXYGENASE INHIBITOR AND AT LEAST ONE CYCLO-OXYGENASE INHIBITOR FOR MODIFYING HAIR AND / OR HAIR GROWTH
WO1997039734A1 (en) 1996-04-23 1997-10-30 The Procter & Gamble Company Methods of regulating skin condition with centella asiatica extract
US5834513A (en) 1996-04-25 1998-11-10 Avon Products, Inc. Oxa diacids and related compounds for treating skin conditions
CN1166960A (en) 1996-06-04 1997-12-10 金建文 Composite beauty masque powder containing spirulina
US5824702A (en) 1996-06-07 1998-10-20 Mount Sinai School Of Medicine Of The City University Of New York Genistein as a preventive against ultraviolet induced skin photodamage and cancer
US5821361A (en) 1996-06-11 1998-10-13 Protein Technologies International, Inc. Recovery of isoflavones from soy molasses
BR9602991A (en) 1996-07-05 1998-04-28 Cosmeticos Natural Ind Com Skin moisturizing and protective cosmetic compositions against ultraviolet and infrared radiation
DK0996409T3 (en) * 1996-07-12 2003-08-11 Johnson & Johnson Consumer Preparation to delay hair growth and similar use
BR9603084A (en) 1996-07-12 1998-05-05 Cosmeticos Natural Ind Com Dry emulsion composition for skin
JPH10120560A (en) 1996-08-26 1998-05-12 Sankyo Co Ltd Loxoprofen-containing preparation for external use
DE19634206C2 (en) 1996-08-26 2000-01-20 Ludwig Reinke Skin care products, in particular for aging skin
US5804234A (en) 1996-09-13 1998-09-08 Suh; John D. Plant protein for nutritional products and method of making same
DE19638534A1 (en) 1996-09-20 1998-03-26 Beiersdorf Ag Use of tocopheryl ferulate as skin bleaching agent
FR2753626B1 (en) 1996-09-20 1998-11-06 Centre International De Rech Dermatologiques Galderma Cird Galderma NOVEL TOPICAL COMPOSITIONS IN THE FORM OF A FLUID O / W EMULSION WITH A HIGH PRO-PENETRATING GLYCOL CONTENT
US5665367A (en) 1996-09-27 1997-09-09 Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. Skin care compositions containing naringenin and/or quercetin and a retinoid
FR2754713B1 (en) 1996-10-22 1999-01-08 Roc Sa USE OF COMPLEXES FOR THE PREPARATION OF COMPOSITIONS FOR THE TREATMENT OF SENSITIVE SKIN, PREPARATION METHOD AND HYPOALLERGENIC COMPOSITIONS
US6593290B1 (en) 1996-11-01 2003-07-15 Genentech, Inc. Treatment of inner ear hair cells
JPH10139654A (en) * 1996-11-08 1998-05-26 Lion Corp Composition for external skin use
IT1288257B1 (en) 1996-11-29 1998-09-11 Paoli Ambrosi Gianfranco De COMPOSITION FOR COSMETIC, PHARMACEUTICAL OR DIETETIC USE BASED ON AN AMINO SUGAR AND / OR A POLYHYDROXYL ACID
FR2757767B1 (en) 1996-12-27 1999-02-05 Oreal TOPICAL COMPOSITION CONTAINING AT LEAST ONE PLANT-BASED PROTEIN AND / OR ANIMAL-BASED PROTEIN AND A POLY (2-ACRYLAMIDO 2-METHYLPROPANE SULFONIC ACID) CROSSLINKED
DE19818849A1 (en) 1997-04-28 1998-10-29 Med Beauty Ag Formulation to promote deep skin penetration
US5962015A (en) 1997-05-02 1999-10-05 Kobo Products S.A.R.L. Stabilized liposomes
US6060070A (en) 1997-06-11 2000-05-09 Gorbach; Sherwood L. Isoflavonoids for treatment and prevention of aging skin and wrinkles
FR2765106B1 (en) 1997-06-27 2000-12-15 Dior Christian Parfums USE OF CROSSLINKED TANNINS IN THE PRESENCE OF NON-CROSSLINKED PROTEINS WITH TANNINS AS COSMETIC AGENTS TO IMPROVE SKIN SMOOTHING AND / OR TO OBTAIN AN ASTRINGENT EFFECT
US8039026B1 (en) 1997-07-28 2011-10-18 Johnson & Johnson Consumer Companies, Inc Methods for treating skin pigmentation
DE19735587B4 (en) 1997-08-16 2012-03-22 Eberhard-Karls-Universität Tübingen Universitätsklinikum A peptide having a radioprotective effect, a cosmetic or pharmaceutical composition containing the same, a nucleic acid encoding the same, a preparation process for this peptide and the use as a radioprotective agent
AR015455A1 (en) 1997-09-23 2001-05-02 Novartis Ag METHOD FOR THE SURFACE TREATMENT OF A POLYMERIC ARTICLE, AND SUCH ARTICLE OBTAINED
US5972355A (en) 1997-09-30 1999-10-26 E-L Management Corp. Stable compositions containing biologically active components
US5928658A (en) 1997-12-05 1999-07-27 U.S. Cosmetics Oil-free wax-free solid cosmetic composition
CA2314899A1 (en) 1997-12-16 1999-06-24 Johnson & Johnson Consumer Companies, Inc. Compositions and methods for regulating phagocytosis and icam-1 expression
DE19804376B4 (en) 1998-02-04 2004-09-16 Johnson & Johnson Gmbh Lipid mixtures and their use
US5928889A (en) 1998-02-13 1999-07-27 S.C. Johnson & Son, Inc. Protocol for simulated natural biofilm formation
US5965153A (en) 1998-03-24 1999-10-12 Stabar Enterprises, Inc. Dietary supplement for preventing or reducing shedding by animals
US6323219B1 (en) * 1998-04-02 2001-11-27 Ortho-Mcneil Pharmaceutical, Inc. Methods for treating immunomediated inflammatory disorders
ID27989A (en) 1998-05-05 2001-05-03 Bausch & Lomb PLASMA SURFACE TREATMENT IN HYDRAULIC SILICONE CONTACT LENS
US6087415A (en) 1998-06-11 2000-07-11 Johnson & Johnson Vision Care, Inc. Biomedical devices with hydrophilic coatings
US6750229B2 (en) * 1998-07-06 2004-06-15 Johnson & Johnson Consumer Companies, Inc. Methods for treating skin pigmentation
EP1120108B1 (en) 1998-10-09 2006-08-02 Kabushiki Kaisha Yakult Honsha Skin care preparations for external use
US20020006418A1 (en) 1998-10-13 2002-01-17 John Kung Composition to enhance permeation of topical skin agents
US6096327A (en) 1998-11-05 2000-08-01 Protease Sciences Inc. Cosmetic compositions containing human type serine protease inhibitors for revitalizing the skin
US6521237B2 (en) 1998-11-12 2003-02-18 Johnson & Johnson Consumer Companies, Inc. Skin care composition
US20020197244A1 (en) 1998-12-07 2002-12-26 Miri Seiberg Compositions and methods for regulating phagocytosis and ICAM-1 expression
DE69915697T2 (en) 1999-01-19 2005-01-13 Pharmacia & Upjohn Co., Kalamazoo Packing procedure for oxidation-sensitive drugs
AU3390400A (en) 1999-03-05 2000-09-21 Johns Hopkins University, The Regulating skin appearance and composition with a fluorinated vitamin d3 analog compound
WO2000062741A2 (en) 1999-04-19 2000-10-26 The Procter & Gamble Company Skin care compositions containing combination of skin care actives
US6492326B1 (en) 1999-04-19 2002-12-10 The Procter & Gamble Company Skin care compositions containing combination of skin care actives
AU4647200A (en) 1999-04-19 2000-11-02 Procter & Gamble Company, The Skin care compositions containing combination of skin care actives
AU4647300A (en) 1999-04-19 2000-11-02 Procter & Gamble Company, The Skin care compositions containing combination of skin care actives
US6444647B1 (en) 1999-04-19 2002-09-03 The Procter & Gamble Company Skin care compositions containing combination of skin care actives
US6261603B1 (en) 1999-05-11 2001-07-17 Mcelwain Elizena A. Skin cream
US6447809B1 (en) 1999-05-11 2002-09-10 Metagenics, Inc. Composition for promoting healthy bone structure
CN1177580C (en) 1999-05-17 2004-12-01 宝洁公司 Methods for regulating the condition of mammalian keratinous tissue via topical application of phytosterol compositions
JP2002544218A (en) 1999-05-18 2002-12-24 ザ、プロクター、エンド、ギャンブル、カンパニー Methods for adjusting keratin tissue status in mammals
AU5026600A (en) 1999-05-18 2000-12-05 Procter & Gamble Company, The Methods of regulating the condition of mammalian keratinous tissue
AU5026700A (en) 1999-05-18 2000-12-05 Procter & Gamble Company, The Methods for upregulating and/or modulating kgf production and increasing receptivity of keratinocytes to kgf
JP3661981B2 (en) 1999-06-09 2005-06-22 株式会社ノエビア Antiperspirant
US6391288B1 (en) 1999-07-27 2002-05-21 Shiseido Co., Ltd. Microcapsule and method of making the same
BR0007404A (en) 1999-11-05 2002-04-09 Johnson & Johnson Consumer Soy compositions for depigmentation and skin care
JP2003514001A (en) 1999-11-16 2003-04-15 ユニリーバー・ナームローゼ・ベンノートシヤープ Beauty composition comprising chickpea extract and retinoid
FR2803747B1 (en) 2000-01-18 2003-12-26 Pharmascience Lab USE OF ISOFLAVONES AND / OR EXTRACTS OF AFRICAN PLUM IN PHARMACY, COSMETICS AND AS A FOOD ADDITIVE.
FR2807320B1 (en) 2000-04-10 2002-05-24 Oreal USE OF ASCORBIC ACID DERIVATIVES FOR INCREASING THE SYNTHESIS OF EPIDERMAL CRERAMIDES
US6433025B1 (en) 2000-04-13 2002-08-13 Cyanotech Corporation Method for retarding and preventing sunburn by UV light
US6558656B2 (en) 2000-04-20 2003-05-06 Morris Mann Oral and topical compositions and methods related thereto in the treatment of acne
FR2811226B1 (en) 2000-06-05 2003-06-20 Clarins Laboratoires S A S MOISTURIZING COSMETIC COMPOSITION COMPRISING A PLANT TRYPSIN INHIBITOR
US6432424B1 (en) 2000-06-29 2002-08-13 Johnson & Johnson Consumer Companies, Inc. Cosmetic compositions containing creatine, carnitine, and/or pyruvic acid
KR20020025804A (en) 2000-09-29 2002-04-04 미쉘 지. 멘지니 Composition to enhance permeation of topical skin agents
US6482446B2 (en) 2000-12-01 2002-11-19 Neutrogena Corporation Astringent composition and method of use
EP1352637B1 (en) 2000-12-22 2009-07-01 Shiseido Company, Ltd. Hair growth inhibitors and compositions containing the same
JP4169514B2 (en) 2001-01-31 2008-10-22 松下電器産業株式会社 Method and apparatus for manufacturing spiral electrode group
BR0207663A (en) 2001-02-27 2005-10-25 Univ Michigan Use of natural egfr inhibitors to prevent side effects due to therapy with retinoids, soaps and other stimuli that activate the epidermal growth factor receptor.
DE60235132D1 (en) 2001-02-28 2010-03-11 Johnson & Johnson Consumer Sojaprodukte containing compositions
US20020160061A1 (en) 2001-02-28 2002-10-31 Claude Saliou Use of legume products for the treatment of external aggressions
US7192615B2 (en) 2001-02-28 2007-03-20 J&J Consumer Companies, Inc. Compositions containing legume products
AU2002305054B2 (en) 2001-03-16 2006-09-07 Johnson & Johnson Consumer Inc. Composition containing feverfew extract and use thereof
US20030224075A1 (en) 2002-02-21 2003-12-04 Jue-Chen Liu Soy composition for balancing combination skin
JP2004000019A (en) 2002-03-27 2004-01-08 Ikeda Shokken Kk Denaturation inhibitor and liquid composition
US20050022314A1 (en) 2003-07-30 2005-02-03 Hal Ambuter Processes
EP1543823A1 (en) 2003-12-19 2005-06-22 Johnson & Johnson Consumer France SAS Gingko containing formulations for the improvement of skin radiance

Patent Citations (99)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2924525A (en) * 1957-06-03 1960-02-09 Central Soya Co Poultry treatment for skin pigmentation
US2876164A (en) * 1957-08-01 1959-03-03 Dome Chemicals Inc Dermatological preparation containing defatted soy bean flour
US4007266A (en) * 1968-05-03 1977-02-08 Choay S.A. Pharmaceutical composition containing vitamin B12, process of making the same and method of treatment
US4386067A (en) * 1969-04-30 1983-05-31 Expanscience Cosmetic compositions
US4331692A (en) * 1971-07-23 1982-05-25 Ulla Drevici Cocoa fruits and products
US4254105A (en) * 1975-10-11 1981-03-03 The Lion Dentifrice Co., Ltd. Multiple emulsion having a form of water/oil/water phase and process for preparation thereof, and multiple emulsion type cosmetics
US4151304A (en) * 1976-11-05 1979-04-24 Lever Brothers Company Method and composition for moisturizing the skin
US4370315A (en) * 1977-02-22 1983-01-25 Sederma Post-depilatory composition reducing progressively the growth of body hair
US4190671A (en) * 1977-03-17 1980-02-26 Biorex Laboratories Limited Chalcone derivatives
US4434095A (en) * 1979-02-04 1984-02-28 Institute Organicheskogo Sinteza Cyclic analogue of naturally-occurring phagocytosis-stimulant peptide - threonyl-cyclo-[-N.sup.ε -lysyl-prolyl-arginyl]
US4427670A (en) * 1980-03-27 1984-01-24 Mitsubishi Chemical Industries Limited Skin preparation
US4515778A (en) * 1981-03-12 1985-05-07 Wolfgang Kastell Preparation for conditioning and grooming the hair
US4437895A (en) * 1981-07-23 1984-03-20 Societe Anonyme Dite: L'oreal Mixture of vegetable oils based on jojoba oil and cosmetic compositions comprising the mixture
US4439418A (en) * 1981-07-29 1984-03-27 Henkel Kgaa Topical preparations for the treatment of seborrhea and process for inhibiting sebum production
US4368187A (en) * 1981-08-03 1983-01-11 Eli Lilly And Company Sensitive-skin care regime
US4382960A (en) * 1981-08-03 1983-05-10 Eli Lilly And Company Cosmetic cleanser formulation
US4578267A (en) * 1981-09-15 1986-03-25 Morton Thiokol, Inc. Skin conditioning polymer containing alkoxylated nitrogen salts of sulfonic acid
US4512973A (en) * 1983-10-12 1985-04-23 Genentech, Inc. Method for overcoming trypsin inhibition
US5192332A (en) * 1983-10-14 1993-03-09 L'oreal Cosmetic temporary coloring compositions containing protein derivatives
US4584190A (en) * 1983-11-17 1986-04-22 Kao Corporation Novel chalcone derivatives and ultraviolet absorbers comprising the same
US4727088A (en) * 1984-02-06 1988-02-23 Neutrogena Corporation Retinoid composition having enhanced bioavailability and percutaneous absorption
US4834076A (en) * 1985-04-17 1989-05-30 Millet Jean M Device for treating the external human epithelium, process for its manufacture and process for using such a device
US5006337A (en) * 1987-04-16 1991-04-09 Marbert Gmbh Medicinal compositions based on spent brewers' grains extract, a process for the preparation thereof, and the use of spent brewers' grains extract for the preparation of cosmetic compositions, and a special brewers' grains extract
US4824662A (en) * 1987-06-15 1989-04-25 Vi-Jon Laboratories, Inc. Nail polish remover
US4895839A (en) * 1987-07-10 1990-01-23 INDENZA S.p.A. Pharmaceutical and cosmetic compositions containing complexes of flavanolignans with phospholipids
US5104655A (en) * 1987-07-27 1992-04-14 Indena S.P.A. Polyunsaturated acids having vasokinetic action and pharmaceutical and cosmetic formulations containing them
US5002761A (en) * 1988-05-02 1991-03-26 Henkel Kommanditgesellschaft Auf Aktien Hair treatment compositions containing natural ingredients
US4906457A (en) * 1988-09-06 1990-03-06 Washington State University Research Foundation, Inc. Compositions and methods for reducing the risk of sunlight and ultraviolet induced skin cancer
US5194252A (en) * 1989-07-27 1993-03-16 Vijon Laboratories, Inc. Moisture retaining aftershave
US5179091A (en) * 1990-06-22 1993-01-12 Adir Et Compagnie Chalcones
US5407675A (en) * 1990-08-10 1995-04-18 Etemad-Moghadam; Parviz Method and composition for use on the scalp and eyebrow region of a subject
US5306444A (en) * 1990-08-24 1994-04-26 Shiseido Company Ltd. Washing composition capable of preventing and ameliorating skin irritation
US5110603A (en) * 1991-01-31 1992-05-05 Kao Corporation Bathing preparation for colloidal material
US5188823A (en) * 1991-02-07 1993-02-23 Stepan Company Antiperspirant formulations
US5498420A (en) * 1991-04-12 1996-03-12 Merz & Co. Gmbh & Co. Stable small particle liposome preparations, their production and use in topical cosmetic, and pharmaceutical compositions
US5603949A (en) * 1991-08-01 1997-02-18 Lvmh Recherche Use of a tocopherol phosphate or one of its derivatives, for the preparation of cosmetic or pharmaceutical compositions and compositions so obtained
US5869470A (en) * 1991-11-25 1999-02-09 The Procter & Gamble Company Compositions for regulating skin wrinkles and/or skin atrophy
US5595984A (en) * 1991-11-25 1997-01-21 Richardson-Vicks Inc. Use of salicylic acid for regulating skin wrinkles and/or skin atrophy
US5597814A (en) * 1991-11-25 1997-01-28 Richardson-Vicks Inc. Use of salicylic acid for regulating skin wrinkles and/or skin atrophy
US5605894A (en) * 1991-11-25 1997-02-25 Richardson-Vicks Inc. Compositions for regulating skin wrinkles and/or skin atrophy
US5616572A (en) * 1991-11-25 1997-04-01 Richardson-Vicks Inc. Use of salicylic acid for regulating skin wrinkles and/or skin atrophy
US5393519A (en) * 1992-03-27 1995-02-28 Helene Curtis, Inc. Shampoo compositions
US5397497A (en) * 1992-08-07 1995-03-14 Solvay Fluor Und Derivate Gmbh Bath additive composition containing polyglycerol fatty acid ester mixture
US6048520A (en) * 1992-09-24 2000-04-11 Helene Curtis, Inc. Clear leave-on hair treatment composition and method
US5276058A (en) * 1993-06-09 1994-01-04 Nippon Hypox Laboratories Incorporated 3,4-dihydroxychalcone derivatives
US5614180A (en) * 1993-08-30 1997-03-25 Helene Curtis, Inc. Shampoo-conditioner composition
US5741496A (en) * 1993-09-21 1998-04-21 Laboratoires De Biologie Vegetale Yves Rocher Process for the treatment of skins having dry areas and greasy areas
US5510391A (en) * 1993-10-22 1996-04-23 Mayapple Holdings, Llc Method of treating blood vessel disorders of the skin using vitamin K
US5712356A (en) * 1993-11-26 1998-01-27 Ciba Vision Corporation Cross-linkable copolymers and hydrogels
US5607666A (en) * 1993-12-22 1997-03-04 L'oreal Cosmetic or dermatological powder, its preparation process and its uses
US5620692A (en) * 1993-12-23 1997-04-15 Nurture, Inc. Oat oil compositions with useful cosmetic and dermatological properties
US5607692A (en) * 1993-12-30 1997-03-04 L'oreal Depigmenting composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof
US5601833A (en) * 1993-12-30 1997-02-11 L'oreal Protective, nutritive and/or firming composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof
US5614215A (en) * 1993-12-30 1997-03-25 L'oreal Cosmetic composition for the simultaneous treatment of the surface and deep layers of the skin, its use
US5503832A (en) * 1994-02-15 1996-04-02 De Stoutz; Jean-Christian Method for extracting the soluble material from oil-bearing beans or seeds
US6045779A (en) * 1994-02-18 2000-04-04 Henkel Kommanditgesellschaft Auf Aktien Skin and hair aerosol foam preparations containing an alkyl polyglycoside and vegetable oil
US5505946A (en) * 1994-04-01 1996-04-09 Trustees Of Univ Of Pa Bowman-birk inhibitor concentrate compositions and methods for the treatment of pre-malignant tissue
US6013255A (en) * 1994-04-18 2000-01-11 Gist-Brocades B.V. Stable water-in-oil emulsions
US5885617A (en) * 1994-07-12 1999-03-23 Bpsi Holdings, Inc. Moisture barrier film coating composition, method, and coated form
US6033680A (en) * 1994-12-06 2000-03-07 The Procter & Gamble Company Shelf stable skin cleansing liquid with gel forming polymer and lipid
US6180662B1 (en) * 1994-12-13 2001-01-30 Beiersdorf Ag Agents acting against hyperreactive and hypoactive, deficient skin conditions and manifest dermatitides
US5723148A (en) * 1995-01-05 1998-03-03 Novartis Corp. Topical pharmaceutical compositions
US5618522A (en) * 1995-01-20 1997-04-08 The Procter & Gamble Company Emulsion compositions
US5885948A (en) * 1995-02-15 1999-03-23 The Procter & Gamble Company Crystalline hydroxy waxes as oil in water stabilizers for skin cleansing liquid composition
US5869031A (en) * 1995-03-23 1999-02-09 Pierre Fabre Dermo-Cosmetique Depigmenting dermatological and/or cosmetic composition
US6013250A (en) * 1995-06-28 2000-01-11 L'oreal S. A. Composition for treating hair against chemical and photo damage
US5885593A (en) * 1995-09-28 1999-03-23 The Andrew Jergens Company Skin care composition including cyclodextrin materials and method for treating skin therewith
US6019962A (en) * 1995-11-07 2000-02-01 The Procter & Gamble Co. Compositions and methods for improving cosmetic products
US5880314A (en) * 1995-11-24 1999-03-09 Mitsui Chemicals, Inc. Hydrochalcone derivatives, cosmetic compositions containing said derivatives and methods of producing the same
US5871823A (en) * 1996-06-19 1999-02-16 Huels Aktiengesellschaft Hydrophilic coating of surfaces of polymeric substrates
US5888522A (en) * 1996-08-23 1999-03-30 Skin Biology, Inc. Tissue protective and regenerative compositions
US5871743A (en) * 1996-10-31 1999-02-16 Chajuss; Daniel Topical application of soy molasses
US6018001A (en) * 1997-01-23 2000-01-25 Menicon Co., Ltd. Process for producing contact lens with hydrophilic surface and contact lens obtained thereby
US5863546A (en) * 1997-03-02 1999-01-26 Swinehart; James M Cosmetic composition
US5885600A (en) * 1997-04-01 1999-03-23 Burlington Bio-Medical & Scientific Corp. Natural insect repellent formula and method of making same
US6183762B1 (en) * 1997-05-27 2001-02-06 Sembiosys Genetics Inc. Oil body based personal care products
US5885596A (en) * 1997-07-23 1999-03-23 Bristol-Myers Squibb Company Methods and compositions for fine lines and/or wrinkles
US6017893A (en) * 1997-08-29 2000-01-25 Natures Sunshine Products, Inc. Use of isoflavones to prevent hair loss and preserve the integrity of existing hair
US6017549A (en) * 1997-09-30 2000-01-25 E-L Management Corp. Non-irritating cosmetic and pharmaceutical compositions
US6054137A (en) * 1997-12-19 2000-04-25 Societe L'oreal S.A. Promoting epidermal renewal with phloroglucinol
US6030931A (en) * 1998-02-03 2000-02-29 Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. Foaming cleansing skin product
US6051602A (en) * 1998-03-16 2000-04-18 The Procter & Gamble Company Methods for regulating skin appearance
US6183761B1 (en) * 1998-03-16 2001-02-06 The Procter & Gamble Company Compositions for regulating skin appearance
US20050036963A1 (en) * 1998-07-06 2005-02-17 Archana Sah Compositions and methods for treating skin conditions
US20040067244A1 (en) * 1999-03-22 2004-04-08 Friedman Doron I. Nano oil in glycerin emulsion
US20020034489A1 (en) * 1999-06-10 2002-03-21 Benjamin Wiegland Personal care formulations
US6551606B1 (en) * 1999-06-10 2003-04-22 Coty B.V. Cosmetic product containing enzymes
US20020035046A1 (en) * 1999-07-01 2002-03-21 Lukenbach Elvin R. Personal care compositions
US20030064048A1 (en) * 1999-07-27 2003-04-03 Miri Seiberg Reducing hair growth, hair follicle and hair shaft size and hair pigmentation
US20040009142A1 (en) * 2000-07-26 2004-01-15 Marie-France Zambaux Synergistically active mixture which inhibits hair growth
US20040062731A1 (en) * 2000-10-27 2004-04-01 Miri Seiberg Topical anti-cancer compositions and methods of use thereof
US20030064049A1 (en) * 2000-10-27 2003-04-03 Miri Seiberg Topical anti-cancer compositions and methods of use thereof
US6555143B2 (en) * 2001-02-28 2003-04-29 Johnson & Johnson Consumer Products, Inc. Legume products
US20050008665A1 (en) * 2001-10-13 2005-01-13 Beiersdorf Ag Cosmetic or dermatological active ingredient combination
US20050019279A1 (en) * 2001-11-09 2005-01-27 Beiersdorf Ag Cosmetic or dermatological preparation containing an octadecene dioic acid and a UV filtering substance
US20040063593A1 (en) * 2002-09-30 2004-04-01 Wu Jeffrey M. Compositions containing a cosmetically active organic acid and a legume product
US20050004561A1 (en) * 2003-07-01 2005-01-06 Lynn Halas Method for removing hair
US20070009459A1 (en) * 2003-08-26 2007-01-11 Stephanie Magnant Stabilized antiperspirant compositions containing soy products
US20070041931A1 (en) * 2003-10-29 2007-02-22 Muriel Morelli Compositions Comprising Soy Products and Dioic Acids

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110081305A1 (en) * 2009-10-02 2011-04-07 Steven Cochran Compositions comprising a skin-lightening resorcinol and a skin darkening agent
EP2316411A2 (en) 2009-10-02 2011-05-04 Johnson & Johnson Consumer Companies, Inc. Compositions comprising a skin-lightening resorcinol and a skin darkening agent
US9289361B2 (en) 2009-10-02 2016-03-22 Johnson & Johnson Consumer Inc. Compositions comprising an NFκB-inhibitor and a non-retinoid collagen promoter
US9370474B2 (en) 2009-10-02 2016-06-21 Johnson & Johnson Consumer Inc. High-clarity aqueous concentrates of 4-hexylresorcinol
US9375395B2 (en) 2009-10-02 2016-06-28 Johnson & Johnson Consumer Inc. Compositions comprising an NFκB-inhibitor and a tropoelastin promoter
US9629794B2 (en) 2009-10-02 2017-04-25 Johnson & Johnson Consumer Inc. Compositions comprising an NFκB-inhibitor and a tropoelastin promoter
US10307352B2 (en) 2012-09-24 2019-06-04 Johnson & Johnson Consumer Inc. Low oil compositions comprising a 4-substituted resorcinol and a high carbon chain ester
WO2018162645A1 (en) 2017-03-08 2018-09-13 Amazentis Sa Skin treatment methods

Also Published As

Publication number Publication date
DE69821913D1 (en) 2004-04-01
HUP0000216A2 (en) 2000-06-28
US8039026B1 (en) 2011-10-18
US20120027706A1 (en) 2012-02-02
JP2009114187A (en) 2009-05-28
CN1234735A (en) 1999-11-10
KR20000068645A (en) 2000-11-25
BR9806118A (en) 1999-08-31
AU8756698A (en) 1999-02-16
ES2215317T3 (en) 2004-10-01
HUP0000216A3 (en) 2003-04-28
WO1999004752A2 (en) 1999-02-04
DK0948308T3 (en) 2004-06-14
ATE260083T1 (en) 2004-03-15
KR100691395B1 (en) 2007-03-09
WO1999004752A3 (en) 1999-05-14
CA2267077C (en) 2013-06-18
CA2267077A1 (en) 1999-02-04
PL333284A1 (en) 1999-11-22
CN1234735B (en) 2015-09-16
DE69821913T2 (en) 2004-12-23
BR9816322B1 (en) 2014-07-15
PT948308E (en) 2004-07-30
JP2001502360A (en) 2001-02-20
ID22061A (en) 1999-08-26
WO1999004752A9 (en) 1999-04-08
EP0948308B1 (en) 2004-02-25
IL129090A0 (en) 2000-02-17
AR016780A1 (en) 2001-08-01
JP4401441B2 (en) 2010-01-20
EP0948308A1 (en) 1999-10-13
TW557216B (en) 2003-10-11

Similar Documents

Publication Publication Date Title
US8039026B1 (en) Methods for treating skin pigmentation
US6750229B2 (en) Methods for treating skin pigmentation
US6323219B1 (en) Methods for treating immunomediated inflammatory disorders
EP2640346B1 (en) Cosmetic compositions and methods for inhibiting or reducing trypsin activity based on cyclohexane-1,2,3,4,5,6-hexol and a n-acyl amino acid compound
CN109998938B (en) Polypeptide composition for whitening, brightening and lightening spots
MXPA01006891A (en) Soy depigmenting and skin care compositions.
JP5010582B2 (en) Depigmenting or glossy cosmetic composition comprising at least one oxazoline as an active ingredient
AU2010249270B2 (en) Methods for treating skin pigmentation
MXPA99003054A (en) Methods for treating skin pigmentation
KR102561289B1 (en) Peptide for whitening and cosmetic composition with improved percutaneous absorption comprising the same
CZ104699A3 (en) Method of influencing skin pigmentation and composition for making the same

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION