Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
  • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
  • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
  • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
  • C12N9/2465—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on alpha-galactose-glycoside bonds, e.g. alpha-galactosidase (3.2.1.22)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
  • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
  • C12Y302/01015—Polygalacturonase (3.2.1.15)

Definitions

• the invention relates to a DNA sequence which is active as a promoter in yeast cells, an expression and optionally secretion system containing the same, plasmids containing this system, host cells transformed with the DNA and methods for producing proteins and polypeptides.
• K.marxianus can use a variety of carbon and energy sources for growth and is not very temperature sensitive.
• Kluyveromyces maxrxianus can grow at temperatures up to 45 ° C and is therefore easier to grow than the temperature-sensitive Saccharo / 77yce $ strains.
• the cells of fast growing K.marxian ⁇ s strains can divide every 35 minutes under optimal conditions.
• the nucleotide sequence according to the invention comprises a sequence which is active as a promoter and provides an expression system which is very variable and is suitable for Kluyveromyces, but can also be used for other types of yeast, in particular Saccharomyces cerevisiae.
• the DNA sequence according to the invention according to SEQ ID No. 1 is a nucleic acid sequence which contains regulatory regions of a gene which codes for the enzyme endopolygalacturonase.
• the enzyme endopolygalacturonase breaks down pectin by breaking 1,4- ⁇ -D-galactosituronic bonds between two non-methylated galacturonic acid residues.
• This enzyme occurs in yeast strains of the species Kluyveromyces marxian ⁇ s, among others.
• the sequence of the endo- polygalacturonasegens from Kluyveromyces marxianus var. marxianus was published in Yeast 15, 31 1 -322 (1999). However, the promoter region that can be derived from the specified sequence did not reliably lead to the expression of various proteins.
• SEQ ID No. 1 a sequence which comprises at least part of the nucleotides of SEQ ID No. 1, preferably at least nucleotides 1 to 1 134 and in particular the entire sequence, enables the expression of proteins in a very advantageous and reproducible manner .
• the claimed sequence according to SEQ ID No. 1 has several regulatory components, so that it can perform its function as a promoter under the most varied of conditions.
• the promoter according to the invention can be induced by adding pectin to the culture medium. This is advantageous since pectin is a readily available substance and therefore a cheap induction agent is available for the system according to the invention.
• nucleic acid sequences with regulatory activity include those sequences which have arisen by modification, substitution, deletion or insertion or combinations thereof, which have the same or a better regulatory activity than the promoter, the terminator or the signal sequence.
• sequence according to SEQ ID No. 1 can also be included with further regulatory upstream sequences with activator and / or reporter functions.
• those sequences are furthermore considered which have a homology with the claimed nucleotides or sequences of at least 80%, more preferably at least 90% and in particular 95%, as long as they also have a comparable activity.
• the sequence according to SEQ ID No. 1 is preferably provided in the form of an expression system or an expression cassette for the expression of proteins and peptides.
• the expression cassette according to the invention comprises a regulatory sequence as shown in SEQ ID No. 1 or a part thereof active as a promoter, an insertion cloning site into which the polynucleotide for the protein to be expressed can be cloned, and the nucleotide sequence according to SEQ ID No.
• the expression cassette can be used in many ways.
• the insertion cloning site is an interface where the sequence can be cut open and the polynucleotide for the desired protein or peptide can be ligated in.
• the protein is produced intracellularly after induction during expression and is not removed from the cell. After disruption of the cell, it can then be obtained in a manner known per se.
• This embodiment is suitable both for small peptides and proteins that are unstable outside the cell and for proteins that are generally located intracellularly.
• an expression and secretion system according to the invention is used.
• this system comprises the nucleic acid sequence according to SEQ ID No. 1 or a part thereof active as a promoter, the sequence according to SEQ ID No. 2 as a terminator and, between these two sequences, the signal sequence according to SEQ ID No. 3
• the cultivation is carried out in a manner known per se, wherein either the protein is continuously released into the medium in a continuous process and can be continuously obtained from the fermentation broth, or the cells are cultivated and harvested in a batch process and then the protein from the broth can be won.
• the expression cassette according to the invention is suitable both for the expression of suitable autonomously replicating plasmids and for incorporation into yeast chromosomes via integrative vectors.
• the invention further relates to the plasmids pEPG1-1, pEPG1 -2 and pEPGsec, which are explained in more detail in FIGS. 1 to 3 and which contain the expression systems according to the invention.
• These plasmids are recombinant bacterial plasmids and can be used in the present form for the amplification of the expression cassettes.
• the plasmids are contained in the microorganisms DSM 12919, DSM 12920, DSM 12921 or DSM 12922 * and are deposited with them.
• the expression cassette with suitable restriction endonucleases for the interfaces at the edges of the expression cassette are intended to cut out and insert the expression cassette into a yeast vector.
• the vectors usually contain selection markers in order to be able to select successfully transformed cells in a manner known per se.
• the plasmids can optionally be propagated in f, coli and then used in Kluyveromyces marxianus or another Kl ⁇ yveromyces strain or also another yeast strain.
• Known plasmids based on the Kluyveromyces droso- pKD1 can be used. Descendants of this plasmid are suitable for use in Kluyveromyces marxianus and, when using the expression system according to the invention, lead to effective expression and secretion of foreign proteins in the corresponding host.
• the expression cassette including the polynucleotide to be expressed, can be cut out of the plasmids according to the invention and prepared as above and, as a linear or circularized DNA strand, can be brought into direct contact with yeast cells as an integration cassette in order to be taken up by them. Because of the homology with the endopolyglacturonase gene, the DNA is then taken up in part of the treated cells by exchanging it with the endogalacturonase gene. The selection of successfully transfected yeast
• the expression cassette according to the invention is stably built into chromosomes and, if the cells are grown under optimal conditions, leads to a good yield of the desired protein.
• the number of copies of the system can be adjusted depending on the type of protein or peptide to be expressed. Since the endopolygalacturonase gene is only present once in the yeast chromosome set, a transfection or transformation with the expression system provided according to the invention will also only have one copy of the expression vector per successfully transformed cell. If a higher number of copies is desired, sequences of a gene which is present in a larger number of copies in the chromosome set, e.g. for rDNA, ligated to cause a higher number of exchange events.
• a marker is additionally incorporated into the sequence in a manner known per se, so that the successfully transformed cells can be selected. Methods and markers suitable for this are known to the person skilled in the art and do not require any further explanation here.
• the system according to the invention is very variable.
• only the sequence according to SEQ ID No. 1 or a part thereof active as a promoter can be combined with other nucleic acid sequences which provide further regulatory sequences and with a heterologous nucleotide sequence.
• the sequence according to SEQ ID No. 1 or a part thereof active as a promoter can be combined with the sequence of SEQ ID No. 2 in order to provide a regulatory system which is homologous in Kluyveromyces marxianus and in which the polynucleotide for the protein to be expressed is used or a system of SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No.
• Ki ⁇ yveromyces ZeWen can grow with many different C sources and are not very demanding in terms of other nutrients, and are also insensitive to temperature, a very effective system is provided here.
• the reliable expression of the foreign proteins is achieved by the regulatory sequence of the invention provided according to the invention.
• a system is provided which allows the promising yeast type Kluyveromyces marxianus to be used as a host due to its exceptional physiological performance.
• the system according to the invention is suitable for the expression of peptides, polypeptides, proteins and hybrid molecules including glycosylated proteins.
• the expression cassette can also contain the complete sequence of the endopolygalacturonase enzyme or parts thereof, a sequence for a desired protein being inserted between the endopolygalacturonase gene and the terminator sequence.
• a hybrid is then obtained during expression, from which the endopolygalacturonase is split off in a manner known per se.
• an "expression vector” is a DNA molecule that can be linear or circular and contains a segment that encodes a sequence for a protein or peptide of interest that is operatively linked to regulatory sequences. These regulatory sequences include at least promoter and terminator sequences.
• the expression vector can additionally contain selectable markers and other regulatory elements and must enable the transfer and multiplication in host cells.
• the expression vectors can be replicated autonomously or by integration into the host genome.
• DNA or "polynucleotide” includes polymeric forms of deoxyribonucieotides and ribonucleotides of any length and any modification in single and double-stranded form.
• operatively connected means that the individual segments are arranged so that they serve the intended purpose, i.e. can initiate transcription and can promote expression from the start of replication to the termination sequence.
• the claimed sequences can have further short sequences that do not interfere with the biological activity of the molecule. Furthermore, the claimed sequences also include allelic variants of the sequence, ie alternative forms of the gene which have arisen from mutation.
• allelic variants of the sequence ie alternative forms of the gene which have arisen from mutation.
• the term "protein or peptide” refers to a molecular chain of amino acids with biological activity. The proteins and / or polypeptides can be modified in vivo or in vitro, for example by glycosylation and phosphorylation.
• Hybrid molecules are understood to mean molecules which comprise both homologous parts and heterologous parts, for example those proteins which comprise a combination of endopolygalacturonase or parts thereof with a foreign protein, or for example nucleotide sequences in which DNA from Kluyveromyces marxianus is combined with DNA from other microorganisms ,
• the expression cassette according to the invention is suitable, inter alia, for yeasts of the strains Kluyveromyces and Saccharomyces and is preferably used in yeast strains of the species Kluyveromyces marxianus var. Marxianus.
• a particularly preferred strain with particularly favorable expression properties is Kluyveromyces marxianus var. Marxianus BKM Y-719, which was described by Siekstele et al. 1999 (Yeast 1 5, 31 1 to 322 (1999)).
• Another object of the invention is a process for the production of a recombinant protein, which is characterized in that a yeast cell is transfected or transformed with an autonomously replicating plasmid which comprises an expression cassette according to the invention and a polynucleotide which encodes a foreign protein Yeast cell is grown under conditions suitable for the expression of the foreign protein and the protein wins.
• the invention also relates to a method for producing a recombinant protein, which is characterized in that an expression cassette according to the invention is placed in a yeast cell, where the expression cassette is built into a chromosome, the cell is grown and then the protein is obtained.
• the expression cassette according to the invention is particularly preferably used as a module which enables the construction of episomal or integrative expression vectors which contain the regulatory sequences according to SEQ ID No. 1, 2 and / or 3.
• the expression system according to the invention is suitable for the expression of various heterologous proteins.
• the system is particularly preferably used for the expression of HBVS antigen (hepatitis B virus, surface antigen) and virus protein 1 from polyoma virus. These proteins are antigenic proteins and can be used particularly advantageously as vaccines.
• HBVS antigen hepatitis B virus, surface antigen
• virus protein 1 from polyoma virus.
• Figures 1 to 4 show plasmids with the expression cassettes according to the invention
• Figure 6 shows the primers used in Example 2.
• FIG. 1 shows the plasmid pEPG1-1.
• This plasmid contains an expression cassette with the promoter according to the invention according to SEQ ID No. 1 (referred to as EPGI prom), an insertion cloning site which can be cut with BspT1, and the terminator sequence according to SEQ ID No. 2 (referred to as EPGIterm).
• EPGI prom the promoter according to the invention according to SEQ ID No. 1
• BspT1 an insertion cloning site which can be cut with BspT1
• the terminator sequence according to SEQ ID No. 2 referred to as EPGIterm
• Fig. 2 shows the plasmid pEPG1-2.
• This plasmid contains the expression cassette according to the invention, which has a sequence according to SEQ ID No. 1 with nucleotides 572 to 1 134 (designated EPGI prom), which is active as a promoter, an insertion cloning site which can be cut with BspT1, and a terminator sequence, which comprises nucleotides 28 to 541 of SEQ ID No. 2 (referred to as EPGIterm).
• the insertion cloning site replaces the open reading frame of the endopolygalacturonase gene including the sequences -1 to -12 and 1087 to 1115 of this gene.
• Fig. 3 shows the plasmid pEPGsec.
• This plasmid contains an expression and secretion system of the invention.
• the plasmid contains an expression cassette with a promoter according to SEQ ID No. 1 (referred to as EPGI prom), a terminator according to SEQ ID No. 2 (referred to as EPGIterm), a signal sequence according to SEQ ID No. 3 (referred to as EOGI Iyd) and two interfaces to insert the desired nucleic acid sequence for the protein to be expressed.
• This expression cassette was ligated into the multicloning site of the plasmid pUC19.
• the open reading frame of the endopolygalacturonase gene was removed from positions 75 to 1084 and replaced by a linker with the cloning sites Eco 1471 and BpU 1 1021.
• Figure 4 shows the plasmid pUC19PG.
• a 2.198 kb PstI DNA restriction fragment from a recombinant LambdaGEM TM 12 bacteriophage from a Kluyveromyces marxianus genomic library was ligated into the PstI restriction site of the multicloning site of the plasmid pUC19.
• 5 shows the plasmid pUC19-PG1 a.
• a 2.735 kb Stul-Pvull DNA restriction fragment from a recombinant LambdaGEM TM 12 bacteriophage from a Kluyveromyces marxianus genomic library was replaced in plasmid pUC19 with the 321 kb fragment.
• the bold part of the plasmid corresponds to the DNA fragment from K.marxianus, the thin part shows the part of the plasmid pUC19.
• FIG. 6 shows the primers according to SEQ ID Nos. 4 and 5 used for the cloning of promoter and signal sequence.
• FIG. 7 shows the signal sequence according to SEQ ID No. 3 and the associated signal peptide (with sequence for pre- and prepropeptide) of the endopolygalacturonase from Kluyveromyces marxianus.
• a 2.198 kb Pst 1 DNA fragment containing the complete gene of endopolygalacturonase (EPG1) with the regulatory sequences was inserted into the PstI site of the multicloning site of the bacterial plasmid pUC19.
• This construct is shown in FIG.
• two opposite primers which had a recognition site for the restriction enzyme BstT1 at the 5 'end and had homology with the promoter, signal and / or the terminator sequence of the EPG1 gene at the 3' end, by means of the Plasmid circulating PCR a DNA fragment are generated, which could be circularized with a ligase after restriction with BspT1.
• corresponding linkers had to be ligated in for circularization ligation or the primers contained additional sequences at the 5' end, which represented a common recognition site for the restriction enzyme.
• defined areas of the EPG 1 region can be deleted from the plasmid by restriction and subsequent circularization.
• the recombinant deletion plasmids were amplified in Escherichia coli and served as the basis for the expression cassettes.
• the cassette can then be cut out via the different recognition sites for restriction enzymes in the multicloning site of the plasmid pUC19 and cloned into an episomal or integrative vector for a corresponding yeast strain.
• the cassette can also be used directly as a PstI DNA fragment for integration into a yeast host strain.
• the 321 bp Pvull fragment was exchanged for a Stul / Pvull DNA fragment of 2.735 kb which contains the complete endopolygalacturonase gene, including the regulatory sequences -1 142 to -1 and + 1087 to 1595 from Kluyveromyces marxianus .
• the Stul / Pvull fragment was isolated from a recombinant Lambda GEM TM -12 bacteriophage from a genomic library of Kluyveromyce marxianus.
• a map of the plasmid generated: “pUC19-PG1a” is shown in FIG. 5.
• This plasmid can be used in an analogous manner to example 1 for the generation of expression cassettes. Because the cloning strategy for this plasmid of the multicloning site was completely deleted and the Stul site in the upstream promoter region of the EPG1 gene was destroyed by ligation with the Pvull site in pUC19, the Pvull site remaining downstream to the EPG1 gene and, for example, the unique Narl site in the lacZ part of the pUC19 can be used to cut out the cassette.
• a DNA fragment can be generated which contains the promoter region and the signal sequence according to SEQ ID Nos. 1 and 3.
• the degenerate rPEPG primer has a mismatch to the EPG1 sequence in region 1220 in the 5 'region and thereby generates a Pvull site (CAGCTG) from the EPG1 sequence: CAGTTG.
• This point mutation leads to an amino acid exchange by changing a cysteine codon from TGT to an arginine codon after CGT.
• this exchange is in the portion of endopolygalacturonase that is replaced by the reading frame of a foreign gene and therefore has no influence on expression.
• the Stul / Pvull PCR Fragment can be inserted as a blunt end in the multicloning site of a corresponding vector. Via the Pvull location, open reading frames of genes can be added "in frame", the expression product of which is to be removed from the cell.
• the expression cassette pEPG1-1 was used for the expression of the JCV VPI gene.
• the VPIGen was PCR by using the primers:
• JC5 (SEQ ID NO.6): 5'TCAAGCTTAAGAATGGCCCCAACAAAAAGA 3 'and
• JC3 (SEQ ID NO.7): 5'GTAAGCTTAAGATTACAGCA I I I I I GTCTG 3 '
• the "blunt ended" cassette was inserted into the Sma ⁇ site of the Kluyveromyces vector pKDSU.
• the direction of transcription of the 1 P7 gene is opposite to the transcription of the. S. cerevisiae URA3 gene.
• the recipient (BKM Y-719 ura) was transformed with the expression construct and uracil prototrophic clones were isolated.
• the presence of the expression cassette with the reading frame of the VP1 gene was checked by means of PCR and the primers shown above.
• Selected clones were cultivated in various liquid media.
• the yeast cells were harvested by centrifugation and disrupted in lysis buffer (10mM TRIS-HCl, pH7.5, 0.01% TRITON X100, 1mM CaC, 100mM NaCl with 1mM PMSF) with microglass balls at 0 ° C. The glass spheres were then sedimented by centrifugation (2000 rpm) for 10 minutes.
• the supernatant was layered on a 20% sucrose cushion (in lysis buffer) and centrifuged for 2 hours at 4 ° C and 35000rpm (Beckman L8-75 rotor SW41). The pellet was suspended in lysis buffer and layered on a CsCI gradient (1.24 to 1.38 g / ml CsCI). The centrifugation took place at 4 ° C, 35000rpm for 16 hours in the SW41 rotor.
• "Virus like Particies" of JCV VP1 with an average Particle sizes of 45 nm were obtained from the fractions between 1.3 and 1.34 g / ml CsCI.
• HBV s antigen Production of hepatitis BVirus surface antigen (HBV s antigen):
• the expression cassettes pEPG1-1 and pEPG1-2 were used for the expression of the HBV s antigen gene of the main type (AYW).
• the HBS gene was PCR-engineered using the primers:
• HB5 (SEQ ID No. 8): 5 ⁇ GCC77A4 ⁇ ATAATGGAGAACATCACATCAGG 3 'and
• the "blunt ended" expression cassettes were inserted into the Sma ⁇ site of the Kluyveromyces vector pKDSU.
• the direction of transcription of the HBS gene is opposite to the transcription of the S.cerevisiae URA3 gene.
• the recipient (BKM Y-719 ura) was transformed with the expression constructs and uracil prototrophic clones were isolated on selective medium. Total DNA was isolated from selected clones and used for the detection of the expression cassette by means of PCR. Positive clones were cultured in liquid, synthetic and in complete media and used to generate S-protein particles Yeast cultures were harvested by centrifugation and broken up in PBS buffer with I mM PMSF with microglass balls at 0 ° C.
• the glass balls were then sedimented by centrifugation (2000 rpm) for 10 minutes.
• the supernatant was centrifuged at 14000 rpm for 30 minutes (J20 Rotor Beckman J2-21) sedimented the yeast membrane fraction.
• HBV s antigen sedimented with this fraction and was eluted from the fraction by 0.5% Tween-20 in PBS. After renewed centrifugation at 14000rpm, the supernatant was obtained and separated by CsCI density gradient centrifugation. Highly purified HBV s antigen particles were isolated from the 1.2g / ml CsCI fraction.
• the yield of isolable antigen when cultivated in synthetic media was twice as high with the pEPG 1 -2 cassette than with the pEPG1 -1 cassette.

Applications Claiming Priority (3)

Publications (1)

Family

ID=7921535

Family Applications (1)

Country Status (7)

Families Citing this family (7)

Family Cites Families (3)

• 1999
  • 1999-09-10 DE DE19943383A patent/DE19943383B4/de not_active Expired - Fee Related
• 2000
  • 2000-09-05 AU AU76505/00A patent/AU779818B2/en not_active Ceased
  • 2000-09-05 CA CA002381347A patent/CA2381347A1/en not_active Abandoned
  • 2000-09-05 EP EP00965925A patent/EP1214425A1/de not_active Withdrawn
  • 2000-09-05 JP JP2001523776A patent/JP2003509054A/ja active Pending
  • 2000-09-05 WO PCT/EP2000/008662 patent/WO2001020005A1/de not_active Application Discontinuation
  • 2000-09-05 US US10/070,574 patent/US7132522B1/en not_active Expired - Fee Related

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events